BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 597 chr01p 1629435 1629933 3500219244 63 1629435 1629933 8421504 3 36,9,18 0,81,480 p 350021924400015160 81-180 Polypeptides and nucleic acids encoding same Gangolli 2005 0 598 chr01p 1774555 1774578 3500202197 23 1774555 1774578 8421504 1 23 0 g 350020219700000002 0-23 A study of neural-related microRNAs in the developing amphioxus. - ResearchGate .researchgate.net 0 0 MIR3529 598 chr01p 1774555 1774578 3500095127 23 1774555 1774578 8421504 1 23 0 g 350009512700000002 0-23 A study of neural-related microRNAs in the developing amphioxus. .biomedsearch.com 0 0 MIR3529 599 chr01p 1893483 1893510 3500306361 24 1893483 1893510 8421504 2 7,17 0,10 g 350030636100000575 21-45 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 601 chr01p 2173190 2173215 3500228956 25 2173190 2173215 8421504 1 25 0 c,g 350022895600000023,350022895600000023 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 601 chr01p 2173190 2173215 3500193888 25 2173190 2173215 8421504 1 25 0 c,g 350019388800000023,350019388800000023 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 601 chr01p 2173501 2174819 3500388252 54 2173501 2174819 8421504 2 21,33 0,1285 p 350038825200015108,350038825200015168 0-45,0-45 Fusion Protein and Use Thereof - Patent application www.faqs.org 0 0 601 chr01p 2173507 2174816 3500432629 45 2173507 2174816 8421504 2 15,30 0,1279 p 350043262900015046 0-45 CANINE iPS CELLS AND METHOD OF PRODUCING SAME - Patent application www.faqs.org 0 0 601 chr01p 2173513 2174849 3500230063 72 2173513 2174849 8421504 2 9,63 0,1273 p 350023006300015005 0-72 Method for rejuvenating cells LAPASSET 2012 0 601 chr01p 2190011 2190041 3500425093 25 2190011 2190041 8421504 2 7,18 0,12 g 350042509300000172 0-25 PCR METHODS IN FOODS www.ssu.ac.ir 0 0 603 chr01p 2418213 2418236 3500394666 23 2418213 2418236 8421504 1 23 0 g 350039466600000005,350039466600000006 0-20,0-23 Methods Of Nucleic Acid Analysis Hall 2013 0 603 chr01p 2450466 2459853 3500119552 1997 2450466 2459853 8421504 8 1,22,367,239,60,105,163,1040 0,2,281,2695,4832,5406,7466,8347 p,c,g 350011955200000003,350011955200015071,350011955200015065,350011955200015054,350011955200015046,350011955200000000,350011955200015031,350011955200015024,350011955200015038,350011955200015000,350011955200015013,350011955200000006,350011955200000006 8-31,0-252,0-252,0-108,0-252,0-28,0-252,0-252,0-243,0-222,0-147,20-41,20-41 A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit eb.biologists.org 0 0 603 chr01p 2450466 2459841 3500238085 72 2450466 2459841 8421504 4 1,22,28,21 0,2,7488,9354 c,g 350023808500000003,350023808500000000,350023808500000006,350023808500000006 8-31,0-28,20-41,20-41 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 603 chr01p 2450466 2459841 3500185760 72 2450466 2459841 8421504 4 1,22,28,21 0,2,7488,9354 c,g 350018576000000003,350018576000000000,350018576000000000,350018576000000006,350018576000000006 8-31,0-28,0-28,20-41,20-41 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 604 chr01p 2589280 2589307 3500011687 23 2589280 2589307 8421504 2 10,13 0,14 g 350001168700000006 1-33 Identification of Genus Campylobacter and Four Enteropathogenic Campylobacter Species by PCR .tm.mahidol.ac.th 0 0 619 chr01p 4584617 4584640 3500412677 23 4584617 4584640 8421504 1 23 0 g 350041267700000001 1-24 Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos ev.biologists.org 0 0 619 chr01p 4584617 4584640 3500293514 23 4584617 4584640 8421504 1 23 0 g 350029351400000001 1-24 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 619 chr01p 4584617 4584640 3500233803 23 4584617 4584640 8421504 1 23 0 g 350023380300000001 1-24 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 621 chr01p 4838554 4838584 3500214186 26 4838554 4838584 8421504 3 10,11,5 0,11,25 g 350021418600001244 0-26 Highly conserved genes and their use to generate probes and primers for detection of microorganisms - Patent application www.faqs.org 0 0 621 chr01p 4838554 4838584 3500205565 26 4838554 4838584 8421504 3 10,11,5 0,11,25 g 350020556500001224 0-26 HIGHLY CONSERVED GENES AND THEIR USE TO GENERATE PROBES AND PRIMERS FOR DETECTION OF MICROORGANISMS - Patent application www.faqs.org 0 0 623 chr01p 5033306 5041602 3500011483 1890 5033306 5041602 8421504 12 123,164,110,155,171,147,113,154,139,134,327,153 0,860,1919,2658,3207,3886,4538,4927,5387,6575,7213,8143 p,c 350001148300015000,350001148300000001 0-1887,0-1890 KEGG T01056: 778777 www.genome.jp 0 0 624 chr01p 5124665 5124689 3500216241 24 5124665 5124689 8421504 1 24 0 g 350021624100000329,350021624100000407 2-26,19-43 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 625 chr01p 5289273 5289307 3500395481 27 5289273 5289307 8421504 3 6,16,5 0,10,29 g 350039548100000131 17-44 Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius .patentgenius.com 0 0 625 chr01p 5355906 5356440 3500416406 40 5355906 5356440 8421504 2 20,20 0,514 g 350041640600000014,350041640600000015 0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 628 chr01p 5746618 5746645 3500337023 24 5746618 5746645 8421504 2 8,16 0,11 g 350033702300000039 7-31 Methods and compositions for modulating ACE-2 activity osdir.com/patents 0 0 628 chr01p 5746618 5746645 3500334357 24 5746618 5746645 8421504 2 8,16 0,11 g 350033435700000035,350033435700000047 7-31,7-31 Methods and compositions for modulating ACE-2 activity Parry 2002 0 628 chr01p 5746618 5746645 3500242837 24 5746618 5746645 8421504 2 8,16 0,11 g 350024283700000001 7-31 Methods and compositions for modulating ace-2 activity Parry 2002 0 629 chr01p 5770776 5770802 3500091488 23 5770776 5770802 8421504 2 5,18 0,8 g 350009148800000721 23-46 US Patent # 6,376,210. Methods and compositions for assaying analytes - Patents.com www.patents.com 0 0 629 chr01p 5893879 5894956 3500416406 40 5893879 5894956 8421504 2 20,20 0,1057 c,g 350041640600000011,350041640600000011,350041640600000010,350041640600000010 0-20,0-20,0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 630 chr01p 6024453 6024581 3500124262 57 6024453 6024581 8421504 2 30,27 0,101 p 350012426200015000 3-60 10.1042/BJ20041860 Biochemical Journal Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish Takafumi 2005 0 586 chr01q 140859 140904 3500337504 45 140859 140904 8421504 1 45 0 p 350033750400015004 0-45 prdl-a, a gene marker for hydra apical differentiation related to triploblastic paired-like head-speciﬁc genes ev.biologists.org 0 0 ARX 588 chr01q 515030 515081 3500383952 51 515030 515081 8421504 1 51 0 p 350038395200015056 0-51 Yeast cells expressing modified g proteins and methods of use therefor Benegal 2000 0 GNAI2 73 chr01q 519386 524322 3500345036 45 519386 524322 8421504 2 38,7 0,4929 p 350034503600015002 0-45 Human G-protein alpha i2 C352G GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AGC ACC www.cdna.org 0 0 GNAT2 73 chr01q 519386 524322 3500204636 45 519386 524322 8421504 2 38,7 0,4929 p 350020463600015002 0-45 Human G-protein alpha i2 C352I >KpnI GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AG www.cdna.org 0 0 GNAS 73 chr01q 519386 524322 3500199104 45 519386 524322 8421504 2 38,7 0,4929 p 350019910400015002 0-45 Human G-protein alpha i2 Q205L/D273N GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AG www.cdna.org 0 0 GNAS 73 chr01q 519389 524340 3500147730 60 519389 524340 8421504 2 35,25 0,4926 p 350014773000015019 51-111 Sequenceanalysis cDNAand DNA www.pnas.org 0 0 597 chr01q 1623977 1630744 3500156021 192 1623977 1630744 8421504 7 23,25,20,45,8,49,22 0,44,109,2756,5988,6387,6745 p,c,g 350015602100000002,350015602100000002,350015602100000006,350015602100000000,350015602100000000,350015602100015001,350015602100015000,350015602100000001,350015602100000003,350015602100000003 0-23,0-23,0-25,0-20,0-20,0-45,0-57,0-21,0-22,0-22 Rosaria De Santis ciCD94-1, an ascidian multipurpose C-type lectin-like receptor expressed in Ciona intestinalishemocytes and larval neural structures www.lambris.com 0 0 599 chr01q 1851818 1864817 3500185870 54 1851818 1864817 8421504 2 27,27 0,12972 g 350018587000000006,350018587000000007 0-27,0-27 Supporting Information www.pnas.org 0 0 600 chr01q 2051142 2051172 3500022998 25 2051142 2051172 8421504 3 6,7,12 0,9,18 g 350002299800000144 7-32 Novel Acetylcholinesterase Gene Responsible for Insecticide Resistance and Applications Thereof - Patent application www.faqs.org 0 0 603 chr01q 2383630 2385266 3500416406 40 2383630 2385266 8421504 2 20,20 0,1616 c,g 350041640600000005,350041640600000004,350041640600000004 0-20,0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 605 chr01q 2660841 2660865 3500304259 24 2660841 2660865 8421504 1 24 0 g 350030425900000179 0-24 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 608 chr01q 3017860 3018517 3500270952 657 3017860 3018517 8421504 1 657 0 p 350027095200015019 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500229082 657 3017860 3018517 8421504 1 657 0 p 350022908200015021 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500179578 657 3017860 3018517 8421504 1 657 0 p 350017957800015019 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500072511 657 3017860 3018517 8421504 1 657 0 p 350007251100015018 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 612 chr01q 3625838 3625866 3500395481 23 3625838 3625866 8421504 2 14,9 0,19 g 350039548100000066 4-27 Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius .patentgenius.com 0 0 616 chr01q 4074692 4074717 3500330399 25 4074692 4074717 8421504 1 25 0 g 350033039900000007 0-25 Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis www.pnas.org 0 0 616 chr01q 4074692 4074717 3500327677 25 4074692 4074717 8421504 1 25 0 g 350032767700000008 0-25 14500781 10.1073/pnas.1634991100 0027-8424 Proceedings of the National Academy of Sciences Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Davidson 2003 10 616 chr01q 4074692 4074717 3500295209 25 4074692 4074717 8421504 1 25 0 g 350029520900000008 0-25 14500781 10.1073/pnas.1634991100 0027-8424 Proceedings of the National Academy of Sciences Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Davidson 2003 10 616 chr01q 4074692 4074717 3500274608 25 4074692 4074717 8421504 1 25 0 g 350027460800000008 0-25 10.1073/pnas.1634991100 Proceedings of the National Academy of Sciences of the United States of America Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Brad 2003 0 619 chr01q 4528438 4528812 3500224873 60 4528438 4528812 8421504 2 38,22 0,352 p 350022487300015053,350022487300015010,350022487300015062,350022487300015045 18-78,18-78,0-54,0-54 DissertationABennewizEndfassungelektronische Version 08-2009 diss.fu-berlin.de 0 0 619 chr01q 4528444 4528806 3500374989 48 4528444 4528806 8421504 2 32,16 0,346 p 350037498900015002 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 619 chr01q 4528444 4528806 3500219678 48 4528444 4528806 8421504 2 32,16 0,346 p 350021967800015003 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases Engelhardt 2008 0 619 chr01q 4528444 4528806 3500046035 48 4528444 4528806 8421504 2 32,16 0,346 p 350004603500015002 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 619 chr01q 4528447 4528806 3500235355 45 4528447 4528806 8421504 2 29,16 0,343 p 350023535500015148 0-45 NON-SMALL CELL LUNG CANCER-RELATED GENE, ANLN, AND ITS INTERACTION WITH RhoA - Patent application www.faqs.org 0 0 621 chr01q 4748662 4749387 3500416406 40 4748662 4749387 8421504 2 20,20 0,705 g 350041640600000022,350041640600000023 0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 626 chr01q 5484653 5484678 3500347923 23 5484653 5484678 8421504 3 14,4,5 0,15,20 g 350034792300000031,350034792300000030 8-33,0-25 EVOLUTION OF YY1, YY2, REX1 AND DNA-BINDING MOTIFS IN VERTEBRATE GENOMES etd.lsu.edu 0 0 628 chr01q 5691703 5694357 3500063800 88 5691703 5694357 8421504 4 22,22,22,22 0,526,2283,2632 c,g 350006380000000008,350006380000000008,350006380000000014,350006380000000014,350006380000000015,350006380000000015,350006380000000009,350006380000000009 0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22 10.1073/pnas.0503640102 Proceedings of the National Academy of Sciences of the United States of America Transposon-mediated insertional mutagenesis revealed the functions of animal cellulose synthase in the ascidian Ciona intestinalis Yasunori 2005 0 632 chr01q 6212509 6216008 3500299524 89 6212509 6216008 8421504 3 40,29,20 0,1864,3479 c,g 350029952400000003,350029952400000003,350029952400000004,350029952400000004,350029952400000007,350029952400000007,350029952400000006,350029952400000006,350029952400000008,350029952400000008 0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20 15201221 10.1242/dev.01201 0950-1991 Development Amphioxus and ascidian Dmbx homeobox genes give clues to the vertebrate origins of midbrain development Takahashi 2004 7 633 chr01q 6314381 6314890 3500316042 41 6314381 6314890 8421504 2 21,20 0,489 g 350031604200000009,350031604200000008 0-21,0-20 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 633 chr01q 6321830 6362756 3500454641 75 6321830 6362756 8421504 3 25,25,25 0,14642,40901 c,g 350045464100000002,350045464100000003,350045464100000003,350045464100000004,350045464100000004 0-25,0-25,0-25,0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 633 chr01q 6321830 6362756 3500275698 75 6321830 6362756 8421504 3 25,25,25 0,14642,40901 c,g 350027569800000002,350027569800000003,350027569800000003,350027569800000004,350027569800000004 0-25,0-25,0-25,0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 633 chr01q 6330750 6332592 3500207888 48 6330750 6332592 8421504 2 46,2 0,1840 p 350020788800015006 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2003 0 633 chr01q 6330750 6332592 3500051201 48 6330750 6332592 8421504 2 46,2 0,1840 p 350005120100015009 0-48 PROMOTION OF PEROXISOMAL CATALASE FUNCTION IN CELLS Terlecky 2003 0 633 chr01q 6330759 6332598 3500360151 45 6330759 6332598 8421504 2 37,8 0,1831 p 350036015100015014 0-45 Toxin compounds with enhanced membrane translocation characteristics Fernandez-salas 2004 0 633 chr01q 6330759 6332598 3500280799 45 6330759 6332598 8421504 2 37,8 0,1831 p 350028079900015013 0-45 Toxin compounds with enhanced membrane translocation characteristics Aoki 2006 0 633 chr01q 6330759 6332598 3500160787 45 6330759 6332598 8421504 2 37,8 0,1831 p 350016078700015012 0-45 TOXIN COMPOUNDS WITH ENHANCED MEMBRANE TRANSLOCATION CHARACTERISTICS Fernandez-salas 2008 0 633 chr01q 6330762 6332601 3500364390 45 6330762 6332601 8421504 2 34,11 0,1828 p 350036439000015012 0-45 Quox-1, a Quail Homeobox Gene Expressed in the Embryonic Central Nervous System, Including the Forebrain www.jstor.org 0 0 634 chr01q 6452290 6481854 3500305932 631 6452290 6481854 8421504 3 389,60,182 0,29309,29382 g 350030593200000103,350030593200000080,350030593200000081,350030593200000104,350030593200000083 0-389,0-21,0-21,0-252,0-21 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 637 chr01q 6939077 6940297 3500349597 48 6939077 6940297 8421504 2 37,11 0,1209 p 350034959700015076 0-48 Methods For Identifying Compounds That Alter Kinase Activity www.docstoc.com 0 0 641 chr01q 7433043 7433076 3500454641 33 7433043 7433076 8421504 1 33 0 c,g 350045464100000007,350045464100000006,350045464100000006 0-25,0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 641 chr01q 7433043 7433076 3500275698 33 7433043 7433076 8421504 1 33 0 c,g 350027569800000007,350027569800000006,350027569800000006 0-25,0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 644 chr01q 7743801 7743825 3500239787 23 7743801 7743825 8421504 2 15,8 0,16 c 350023978700000013 7-30 19534778 10.1186/1471-2202-10-60 1471-2202 BMC Neuroscience Functional and comparative genomics analyses of pmp22 in medaka fish Itou 2009 3 644 chr01q 7743801 7743825 3500073626 23 7743801 7743825 8421504 2 15,8 0,16 c 350007362600000018 7-30 BMC Neuroscience BioMed Central biomedcentral.com 0 0 644 chr01q 7770153 7770213 3500332414 60 7770153 7770213 8421504 1 60 0 p 350033241400015009,350033241400015022,350033241400015017,350033241400015013,350033241400015025,350033241400015003,350033241400015002,350033241400015018,350033241400015019,350033241400015014,350033241400015015,350033241400015016,350033241400015010,350033241400015011,350033241400015012,350033241400015109,350033241400015021,350033241400015020,350033241400015023,350033241400015024,350033241400015007,350033241400015006,350033241400015005,350033241400015004,350033241400015008 0-60,0-54,0-51,0-51,0-51,0-51,0-51,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48 INHIBITORS OF TLR SIGNALING BY TARGETING TIR DOMAIN INTERFACES Toshchakov 2013 0 644 chr01q 7770159 7770213 3500456081 54 7770159 7770213 8421504 1 54 0 p 350045608100015001,350045608100015027 3-48,0-48 Patent Anti-pathogen system and methods of use thereof (Patent US:6221355) Dowdy 2001 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500369525 54 7770159 7770213 8421504 1 54 0 p 350036952500015006,350036952500015004 9-54,99-147 Mcl-1 Quadruplex Nucleic Acids And Uses Thereof .freshpatents.com 0 0 644 chr01q 7770159 7770213 3500361379 54 7770159 7770213 8421504 1 54 0 p 350036137900015001,350036137900015027 3-48,0-48 Anti-pathogen system and methods of use thereof Dowdy 1998 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500189837 54 7770159 7770213 8421504 1 54 0 p 350018983700015019,350018983700015038 3-48,0-48 Anti-pathogen system and methods of use thereof Dowdy 2001 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500177121 54 7770159 7770213 8421504 1 54 0 p 350017712100015008,350017712100015006 9-54,99-147 MCL-1 quadruplex nucleic acids and uses thereof Farrell 2006 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770162 7770213 3500326294 51 7770162 7770213 8421504 1 51 0 p 350032629400015005,350032629400015000 0-51,0-48 10064588 10.1093/emboj/18.5.1214 ERROR! NO ISSN The EMBO Journal Translocation of ornithine decarboxylase to the surface membrane during cell activation and transformation Heiskala 1999 0 644 chr01q 7770165 7770216 3500366297 51 7770165 7770216 8421504 1 51 0 p 350036629700015013,350036629700015007,350036629700015005,350036629700015004,350036629700015017 0-51,0-51,0-51,0-51,0-45 Modulation of TRIP-Br function and method of treating proliferative disorders - Patent # 7223733 - PatentGenius .patentgenius.com 0 0 644 chr01q 7770165 7770213 3500466191 48 7770165 7770213 8421504 1 48 0 p 350046619100015002 0-48 PYRROLIDINYL GROUPS FOR ATTACHING CONJUGATES TO OLIGOMERIC COMPOUNDS Swayze 2005 0 HOXB4 644 chr01q 7770165 7770213 3500465520 48 7770165 7770213 8421504 1 48 0 p 350046552000015000,350046552000015001 9-57,9-57 17347452 10.1152/ajpgi.00273.2006 American Journal of Physiology - Gastrointestinal and Liver Physiology Ethanol induced NF-κB activation protects against cell injury in cultured rat gastric mucosal epithelium Mustonen 2007 0 HOXB4 644 chr01q 7770165 7770213 3500463762 48 7770165 7770213 8421504 1 48 0 p 350046376200015015 0-48 Combination therapies with mitochondrial-targeted anti-tumor agents Altieri 2011 0 HOXB4 644 chr01q 7770165 7770213 3500463753 48 7770165 7770213 8421504 1 48 0 p 350046375300015002 0-48 17429072 10.1091/mbc.E06-08-0744 1059-1524 Molecular Biology of the Cell RKIKK Motif in the Intracellular Domain Is Critical for Spatial and Dynamic Organization of ICAM-1: Functional Implication for the Leukocyte Adhesion and Transmigration Oh 2007 5 HOXB4 644 chr01q 7770165 7770213 3500462929 48 7770165 7770213 8421504 1 48 0 p 350046292900015015,350046292900015009 0-48,0-48 GENE SILENCING USING SENSE DNA AND ANTISENSE RNA HYBRID CONSTRUCTS COUPLED TO PEPTIDES FACILITATING THE UPTAKE INTO CELLS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500459634 48 7770165 7770213 8421504 1 48 0 p 350045963400015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7579456) Benedict 2009 0 MIR615 644 chr01q 7770165 7770213 3500459444 48 7770165 7770213 8421504 1 48 0 p 350045944400015021 0-48 Inhibition Of Gasc1 .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500459269 48 7770165 7770213 8421504 1 48 0 p 350045926900015001 0-48 Enhanced efficiency of induced pluripotent stem cell generation Wu 2011 0 HOXB4 644 chr01q 7770165 7770213 3500457784 48 7770165 7770213 8421504 1 48 0 p 350045778400015006 0-48 Modified iRNA agents Manoharan 2004 0 HOXB4 644 chr01q 7770165 7770213 3500457315 48 7770165 7770213 8421504 1 48 0 p 350045731500015001 0-48 23940795 10.1371/journal.pone.0071957 PLoS ONE Phosphorylation of the Actin Binding Protein Drebrin at S647 Is Regulated by Neuronal Activity and PTEN Patricia 2013 0 HOXB4 644 chr01q 7770165 7770213 3500453589 48 7770165 7770213 8421504 1 48 0 p 350045358900015016,350045358900015019 0-48,0-48 Mitochondria-targeted anti-tumor agents Altieri 2009 0 HOXB4 644 chr01q 7770165 7770213 3500452946 48 7770165 7770213 8421504 1 48 0 p 350045294600015027 0-48 Trophinin-binding peptides and uses thereof Fukuda 2008 0 MIR615 644 chr01q 7770165 7770213 3500452430 48 7770165 7770213 8421504 1 48 0 p 350045243000015002 0-48 METHODS OF INDUCING PLURIPOTENCY INVOLVING OCT4 PROTEIN Kirkland 2008 0 HOXB4 644 chr01q 7770165 7770213 3500451805 48 7770165 7770213 8421504 1 48 0 p 350045180500015009 0-48 POLYMERIC CARRIER Stayton 2009 0 HOXB4 644 chr01q 7770165 7770213 3500450490 48 7770165 7770213 8421504 1 48 0 p 350045049000015000 0-48 12788645 10.1016/S1525-0016(03)00130-8 1525-0016 Molecular Therapy A Novel TAT–Mitochondrial Signal Sequence Fusion Protein is Processed, Stays in Mitochondria, and Crosses the Placenta Gaizo 2003 7 HOXB4 644 chr01q 7770165 7770213 3500450280 48 7770165 7770213 8421504 1 48 0 p 350045028000015001 3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:6831065) May 2004 0 HOXB4 644 chr01q 7770165 7770213 3500449540 48 7770165 7770213 8421504 1 48 0 p 350044954000015005 0-48 Therapeutic Compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500447533 48 7770165 7770213 8421504 1 48 0 p 350044753300015019 0-48 特開2010-246542号ＶＨＬ腫瘍サプレッサーと低酸素誘導因子との相互作用、お&#x astamuse.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500446274 48 7770165 7770213 8421504 1 48 0 p 350044627400015000 21-69 18281499 10.1158/0008-5472.CAN-07-6175 0008-5472 Cancer Research Construction of Optimized Bispecific Antibodies for Selective Activation of the Death Receptor CD95 Herrmann 2008 8 HOXB4 644 chr01q 7770165 7770213 3500446139 48 7770165 7770213 8421504 1 48 0 p 350044613900015064,350044613900015085 0-48,0-48 Targeted immunogens Uger 2003 0 HOXB4 644 chr01q 7770165 7770213 3500445605 48 7770165 7770213 8421504 1 48 0 p 350044560500015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500445336 48 7770165 7770213 8421504 1 48 0 p 350044533600015026 0-48 BREAST CANCER-ASSOCIATED GENE, MELK, AND ITS INTERACTIONS WITH BCL-G - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500444542 48 7770165 7770213 8421504 1 48 0 p 350044454200015011 0-48 主题：Regulates | 医源世界 www.39kf.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500443721 48 7770165 7770213 8421504 1 48 0 p 350044372100015004 0-48 Controlling gene expressions in plastids Muhlbauer 2004 0 HOXB5 644 chr01q 7770165 7770213 3500443094 48 7770165 7770213 8421504 1 48 0 p 350044309400015009 0-48 Patent Hemangio-colony forming cells (Patent US:8017393) Lanza 2011 0 HOXC6 644 chr01q 7770165 7770213 3500441271 48 7770165 7770213 8421504 1 48 0 p 350044127100015010 0-48 TRANS-MEMBRANE-ANTIBODY INDUCED INHIBITION OF APOPTOSIS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500440875 48 7770165 7770213 8421504 1 48 0 p 350044087500015001 0-48 Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells ecular-cancer.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500440222 48 7770165 7770213 8421504 1 48 0 p 350044022200015006 0-48 HEMANGIO COLONY FORMING CELLS AND NON-ENGRAFTING HEMANGIO CELLS Lanza 2009 0 HOXB5 644 chr01q 7770165 7770213 3500439758 48 7770165 7770213 8421504 1 48 0 p 350043975800015003,350043975800015004 3-51,3-51 Methods of Treating Hepatitis C Virus Infection - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500437539 48 7770165 7770213 8421504 1 48 0 p 350043753900015023 0-48 COMPOSITIONS FOR NUCLEIC ACID DELIVERY - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500436508 48 7770165 7770213 8421504 1 48 0 p 350043650800015004 0-48 Aptamer therapeutics useful in the treatment of complement-related disorders Benedict 2006 0 HOXB4 644 chr01q 7770165 7770213 3500436372 48 7770165 7770213 8421504 1 48 0 p 350043637200015000,350043637200015002 0-48,0-48 18417477 10.1074/jbc.M710530200 The Journal of Biological Chemistry The Apolipoprotein E-mimetic Peptide COG112 Inhibits the Inflammatory Response to Citrobacter rodentium in Colonic Epithelial Cells by Preventing NF-κB Activation Kshipra June 0 HOXB4 644 chr01q 7770165 7770213 3500433573 48 7770165 7770213 8421504 1 48 0 p 350043357300015001 0-48 Methods of Inducing Tissue Regeneration Blau 2010 0 MIR615 644 chr01q 7770165 7770213 3500430608 48 7770165 7770213 8421504 1 48 0 p 350043060800015001,350043060800015000,350043060800015002 3-51,3-51,3-51 10.1002/ijc.20333 1097-0215 International Journal of Cancer Inhibition of growth and survival of human head and neck squamous cell carcinoma cells by curcumin via modulation of nuclear factor-κB signaling - Aggarwal - 2004 - International Journal of Cancer - Wiley Online Library Aggarwal 2004 0 HOXB4 644 chr01q 7770165 7770213 3500425641 48 7770165 7770213 8421504 1 48 0 p 350042564100015001 0-48 Oligonucleotide Compositions with Enhanced Efficiency Woolf 2010 0 HOXC6 644 chr01q 7770165 7770213 3500423875 48 7770165 7770213 8421504 1 48 0 p 350042387500015004 0-48 Targeting NBS1-ATM Interaction To Sensitize Cancer Cells To Radiotherapy And Chemotherapy Xu 2007 0 HOXB4 644 chr01q 7770165 7770213 3500423289 48 7770165 7770213 8421504 1 48 0 p 350042328900015000 0-48 12902516 0022-1767 The Journal of Immunology Intracellular Domain of Brain Endothelial Intercellular Adhesion Molecule-1 Is Essential for T Lymphocyte-Mediated Signaling and Migration Greenwood 2003 6 HOXC6 644 chr01q 7770165 7770213 3500422960 48 7770165 7770213 8421504 1 48 0 p 350042296000015000 0-48 12902516 0022-1767 The Journal of Immunology Intracellular Domain of Brain Endothelial Intercellular Adhesion Molecule-1 Is Essential for T Lymphocyte-Mediated Signaling and Migration Greenwood 2003 6 HOXB4 644 chr01q 7770165 7770213 3500422615 48 7770165 7770213 8421504 1 48 0 p 350042261500015062,350042261500015021 0-48,0-48 TOPICAL GELS CONTAINING ALPHA CONNEXIN C-TERMINAL (ACT) PEPTIDES - FIRSTSTRING RESEARCH, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500422475 48 7770165 7770213 8421504 1 48 0 p 350042247500015000 0-48 PYRROLIDINYL GROUPS FOR ATTACHING CONJUGATES TO OLIGOMERIC COMPOUNDS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500422214 48 7770165 7770213 8421504 1 48 0 p 350042221400015005,350042221400015014 3-51,3-51 ENTZÜNDUNGSHEMMENDE VERBINDUNGEN UND IHRE VERWENDUNG - Dokument DE60123041T2 www.patent-de.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500421823 48 7770165 7770213 8421504 1 48 0 p 350042182300015006 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING THE CDCA8-AURKB COMPLEX - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500416811 48 7770165 7770213 8421504 1 48 0 p 350041681100015001 0-48 Methods for the Delivery of Oligomeric Compounds - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500415188 48 7770165 7770213 8421504 1 48 0 p 350041518800015006 0-48 Synthetic Lipid Rafts and Methods of Use Khan 2007 0 HOXC6 644 chr01q 7770165 7770213 3500414821 48 7770165 7770213 8421504 1 48 0 p 350041482100015118 0-48 Vivit Polypeptides, Therapeutic Agent Comprising The Same, And Method Of Screening For Anti-cancer Agent .freshpatents.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500414025 48 7770165 7770213 8421504 1 48 0 p 350041402500015040,350041402500015068 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Ghatnekar 2011 0 HOXB5 644 chr01q 7770165 7770213 3500412288 48 7770165 7770213 8421504 1 48 0 p 350041228800015002 0-48 18717816 10.1111/j.1471-4159.2008.05630.x 1471-4159 Journal of Neurochemistry Interaction of caveolin-1, nitric oxide, and nitric oxide synthases in hypoxic human SK-N-MC neuroblastoma cells - Shen - 2008 - Journal of Neurochemistry - Wiley Online Library Shen 2008 0 HOXB4 644 chr01q 7770165 7770213 3500411153 48 7770165 7770213 8421504 1 48 0 p 350041115300015082 0-48 Patent Compositions and methods of use of targeting peptides against placenta and adipose tissues (Patent US:8252764) Pasqualini 2012 0 MIR615 644 chr01q 7770165 7770213 3500410569 48 7770165 7770213 8421504 1 48 0 p 350041056900015003 0-48 Secretion System and Methods for its Use Mougous 2012 0 HOXC6 644 chr01q 7770165 7770213 3500408014 48 7770165 7770213 8421504 1 48 0 p 350040801400015104,350040801400015084,350040801400015126 0-48,0-48,0-48 Composition And Methods For Promoting Wound Healing And Tissue Regeneration .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500405690 48 7770165 7770213 8421504 1 48 0 p 350040569000015008,350040569000015009 0-48,0-48 COMPLEX FOR TRANSFERRING AN ANIONIC SUBSTANCE INTO A CELL - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500403982 48 7770165 7770213 8421504 1 48 0 p 350040398200015016,350040398200015010,350040398200015008,350040398200015012 0-48,0-48,0-48,0-48 Disheveled pdz modulators Costa 2007 0 HOXB4 644 chr01q 7770165 7770213 3500402001 48 7770165 7770213 8421504 1 48 0 p 350040200100015005 0-48 Patent Therapeutic compositions (Patent US:8420799) Manoharan 2013 0 HOXB4 644 chr01q 7770165 7770213 3500401907 48 7770165 7770213 8421504 1 48 0 p 350040190700015003 0-48 10.1091/mbc.E06-08-0744 Molecular Biology of the Cell RKIKK Motif in the Intracellular Domain Is Critical for Spatial and Dynamic Organization of ICAM-1: Functional Implication for the Leukocyte Adhesion and Transmigration Hyun-Mee June 0 HOXB4 644 chr01q 7770165 7770213 3500401579 48 7770165 7770213 8421504 1 48 0 p 350040157900015000 0-48 DSIP | Epitope Tags/Tag Peptides Guide www.ubenimex.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500400715 48 7770165 7770213 8421504 1 48 0 p 350040071500015005 0-48 Patent Therapeutic compositions (Patent US:8110674) Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500400594 48 7770165 7770213 8421504 1 48 0 p 350040059400015001 0-48 17363608 10.1158/0008-5472.CAN-06-4082 0008-5472 Cancer Research Caveolin-1–Deficient Mice Have Increased Tumor Microvascular Permeability, Angiogenesis, and Growth Lin 2007 8 HOXC6 644 chr01q 7770165 7770213 3500399022 48 7770165 7770213 8421504 1 48 0 p 350039902200015000 0-48 Method for preventing or treating memory impairment and pharmaceutical compositions useful therefore Fischer 2013 0 HOXC6 644 chr01q 7770165 7770213 3500398751 48 7770165 7770213 8421504 1 48 0 p 350039875100015000 0-48 Direct Conversion of Cells to Cells of Other Lineages Wernig 2013 0 HOXB4 644 chr01q 7770165 7770213 3500396507 48 7770165 7770213 8421504 1 48 0 p 350039650700015004 0-48 COMPOSITIONS AND METHODS FOR DETECTING AND TREATING HIV INFECTIONS WU 2009 0 MIR615 644 chr01q 7770165 7770213 3500396186 48 7770165 7770213 8421504 1 48 0 p 350039618600015017 0-48 Compositions and Methods for the Delivery of Biologically Active RNAs Polach 2012 0 HOXB4 644 chr01q 7770165 7770213 3500392700 48 7770165 7770213 8421504 1 48 0 p 350039270000015005 0-48 Trans-membrane-antibody induced inhibition of apoptosis Brown 2004 0 MIR615 644 chr01q 7770165 7770213 3500392106 48 7770165 7770213 8421504 1 48 0 p 350039210600015037,350039210600015031 0-48,0-48 Mitochondria-targeted anti-tumor agents Jiang Bing Xian 2010 0 HOXB4 644 chr01q 7770165 7770213 3500390436 48 7770165 7770213 8421504 1 48 0 p 350039043600015002,350039043600015000 3-51,3-51 Anti-inflammatory compounds and uses thereof Ghosh 2002 0 HOXC6 644 chr01q 7770165 7770213 3500388449 48 7770165 7770213 8421504 1 48 0 p 350038844900015005 3-51 Patent Entzündungshemmende verbindungen und ihre verwendung (Patent DE:60123041) GHOSH 2007 0 HOXC6 644 chr01q 7770165 7770213 3500387505 48 7770165 7770213 8421504 1 48 0 p 350038750500015002 0-48 Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof Lee 2009 0 HOXB4 644 chr01q 7770165 7770213 3500383186 48 7770165 7770213 8421504 1 48 0 p 350038318600015007 0-48 Methods of Rejuvenating Cells In Vitro and In Vivo - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500382571 48 7770165 7770213 8421504 1 48 0 p 350038257100015003 0-48 TTK as tumor marker and therapeutic target for lung cancer Nakamura 2012 0 HOXB5 644 chr01q 7770165 7770213 3500381827 48 7770165 7770213 8421504 1 48 0 p 350038182700015000 0-48 Tbc1d7 as tumor marker and therapeutic target for cancer Nakamura 2011 0 MIR615 644 chr01q 7770165 7770213 3500381193 48 7770165 7770213 8421504 1 48 0 p 350038119300015005 0-48 Methods and compositions for delivering polynucleotides Khan 2009 0 HOXC6 644 chr01q 7770165 7770213 3500377058 48 7770165 7770213 8421504 1 48 0 p 350037705800015026 0-48 VIVIT POLYPEPTIDES, THERAPEUTIC AGENT COMPRISING THE SAME, AND METHOD OF SCREENING FOR ANTI-CANCER AGENT - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500374795 48 7770165 7770213 8421504 1 48 0 p 350037479500015037,350037479500015104 0-48,0-48 COMPOSITIONS AND METHODS FOR PROMOTING WOUND HEALING AND TISSUE REGENERATION Gourdie 2007 0 HOXB4 644 chr01q 7770165 7770213 3500373900 48 7770165 7770213 8421504 1 48 0 p 350037390000015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500372129 48 7770165 7770213 8421504 1 48 0 p 350037212900015002,350037212900015001 0-48,60-108 Agent for inhibiting development or progress of proliferative diseases and especially cancer diseases and pharmaceutical composition containing said agent Spaenkuch-Schmitt 2003 0 HOXB4 644 chr01q 7770165 7770213 3500372015 48 7770165 7770213 8421504 1 48 0 p 350037201500015002 0-48 Method for selective oligonucleotide modification Mitsch 2011 0 HOXB4 644 chr01q 7770165 7770213 3500368674 48 7770165 7770213 8421504 1 48 0 p 350036867400015022 0-48 Fusion protein for use as vector Hwu 2002 0 HOXC6 644 chr01q 7770165 7770213 3500368538 48 7770165 7770213 8421504 1 48 0 p 350036853800015020,350036853800015052,350036853800015051 36-84,0-48,39-87 Inhibitors of the interaction between P53 and MDM2 Lane 1997 0 HOXC6 644 chr01q 7770165 7770213 3500368217 48 7770165 7770213 8421504 1 48 0 p 350036821700015001,350036821700015000 3-51,3-51 18978205 10.1182/blood-2008-07-166595 0006-4971 Blood TLR2-dependent eosinophil interactions with mycobacteria: role of α-defensins Driss 2009 10 644 chr01q 7770165 7770213 3500368130 48 7770165 7770213 8421504 1 48 0 p 350036813000015044 0-48 Multimeric peptide conjugates and uses thereof Demeule 2011 0 HOXB4 644 chr01q 7770165 7770213 3500367262 48 7770165 7770213 8421504 1 48 0 p 350036726200015002 0-48 INHIBITION OF ANGIOGENESIS Lagos-quintana 2009 0 HOXB4 644 chr01q 7770165 7770213 3500367224 48 7770165 7770213 8421504 1 48 0 p 350036722400015001 0-48 17363608 10.1158/0008-5472.CAN-06-4082 0008-5472 Cancer Research Caveolin-1–Deficient Mice Have Increased Tumor Microvascular Permeability, Angiogenesis, and Growth Lin 2007 8 HOXB4 644 chr01q 7770165 7770213 3500366636 48 7770165 7770213 8421504 1 48 0 p 350036663600015001 0-48 Carbohydrate conjugates as delivery agents for oligonucleotides - US Patent 8106022 Description ww.patentstorm.us 0 0 HOXB4 644 chr01q 7770165 7770213 3500366555 48 7770165 7770213 8421504 1 48 0 p 350036655500015000 0-48 Способ введения молекулы пнк, конъюг&# www.freepatent.ru 0 0 HOXB4 644 chr01q 7770165 7770213 3500361876 48 7770165 7770213 8421504 1 48 0 p 350036187600015105 0-48 Transducible Polypeptides For Modifying Metabolism .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500361143 48 7770165 7770213 8421504 1 48 0 p 350036114300015228 0-48 Peptidic modulators of the androgen receptor Joyal 2002 0 HOXB4 644 chr01q 7770165 7770213 3500360151 48 7770165 7770213 8421504 1 48 0 p 350036015100015007 0-48 Toxin compounds with enhanced membrane translocation characteristics Fernandez-salas 2004 0 HOXC6 644 chr01q 7770165 7770213 3500358319 48 7770165 7770213 8421504 1 48 0 p 350035831900015001,350035831900015000 9-57,9-57 Ethanol induced NF- B activation protects against cell injury in cultured rat gastric mucosal epithelium--《美国胃肠与肝生理学杂志》--医学期刊频&#x journal.9med.net 0 0 HOXB4 644 chr01q 7770165 7770213 3500352610 48 7770165 7770213 8421504 1 48 0 p 350035261000015005 0-48 Caveolin-1-deficient mice have increased tumor microvascular permeability, angiogenesis, and growth. - ResearchGate .researchgate.net 0 0 HOXC6 644 chr01q 7770165 7770213 3500352503 48 7770165 7770213 8421504 1 48 0 p 350035250300015001,350035250300015007 0-48,0-48 E2F AS A TARGET OF HORMONE REFRACTORY PROSTATE CANCER Bertino 2011 0 HOXC6 644 chr01q 7770165 7770213 3500351230 48 7770165 7770213 8421504 1 48 0 p 350035123000015041 0-48 Peptide Antiestrogen Compositions And Methods For Treating Breast Cancer - Patent 6306832 www.docstoc.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500350992 48 7770165 7770213 8421504 1 48 0 p 350035099200015000 0-48 特開2010-501161号ＲＥＧ４またはＫＩＡＡ０１０１を過剰発現している癌の治&#x astamuse.com 0 0 MIR615 644 chr01q 7770165 7770213 3500350744 48 7770165 7770213 8421504 1 48 0 p 350035074400015004 0-48 INHIBITION OF INFLAMMATION USING ANTAGONISTS OF MUC1 Kufe 2010 0 MIR615 644 chr01q 7770165 7770213 3500348094 48 7770165 7770213 8421504 1 48 0 p 350034809400015005 0-48 Pharmaceutical Composition for Treating Autoimmune, Allergic and Inflammatory Diseases and Delivery Method Thereof - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500346772 48 7770165 7770213 8421504 1 48 0 p 350034677200015018 3-51 PEPTIDES AND APTAMERS FOR TARGETING OF NEURON OR NERVES Tsien 2010 0 HOXC6 644 chr01q 7770165 7770213 3500346493 48 7770165 7770213 8421504 1 48 0 p 350034649300015012 0-48 TREATMENT OF CANCER VIA TARGETING OF IL-13 RECEPTOR-ALPHA2 - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500346275 48 7770165 7770213 8421504 1 48 0 p 350034627500015000 0-48 12788645 10.1016/S1525-0016(03)00130-8 1525-0016 Molecular Therapy A Novel TAT–Mitochondrial Signal Sequence Fusion Protein is Processed, Stays in Mitochondria, and Crosses the Placenta Gaizo 2003 7 HOXB5 644 chr01q 7770165 7770213 3500346273 48 7770165 7770213 8421504 1 48 0 p 350034627300015025 0-48 BLOCKADE OF TL1A-DR3 INTERACTIONS TO AMELIORATE T CELL MEDIATED DISEASE PATHOLOGY Siegel 2008 0 HOXB5 644 chr01q 7770165 7770213 3500345122 48 7770165 7770213 8421504 1 48 0 p 350034512200015013 0-48 DPY-30 Binding Peptides Yang 2012 0 HOXB4 644 chr01q 7770165 7770213 3500341491 48 7770165 7770213 8421504 1 48 0 p 350034149100015003 0-48 Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring Bao 2003 0 HOXB5 644 chr01q 7770165 7770213 3500339578 48 7770165 7770213 8421504 1 48 0 p 350033957800015003 0-48 COMPOSITIONS AND METHODS FOR TREATING CARDIOVASCULAR DISEASE - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500337670 48 7770165 7770213 8421504 1 48 0 p 350033767000015003 0-48 METHOD FOR TREATING OR PREVENTING BLADDER CANCER USING THE DEPDC1 POLYPEPTIDE - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500336324 48 7770165 7770213 8421504 1 48 0 p 350033632400015000 0-48 Conjugate of a transport protein and a protein for modulation of notch signalling Champion 2002 0 MIR615 644 chr01q 7770165 7770213 3500335879 48 7770165 7770213 8421504 1 48 0 p 350033587900015006 0-48 METHOD FOR INTRODUCING A PNA MOLECULE CONJUGATED TO A POSITIVELY CHARGED PEPTIDE INTO THE CYTOSOL AND/OR THE NUCLEUS BY PHOTOCHEMICAL INTERNALISATION (PCI) - THE NORWEGIAN RADIUM HOSPITAL RESEARCH FOUNDATION www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500333591 48 7770165 7770213 8421504 1 48 0 p 350033359100015011 0-48 NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500333330 48 7770165 7770213 8421504 1 48 0 p 350033333000015009 0-48 METHODS AND COMPOSITIONS FOR DELIVERY OF ACTIVE AGENTS Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500332070 48 7770165 7770213 8421504 1 48 0 p 350033207000015070,350033207000015088,350033207000015107 0-48,0-48,0-48 Composition And Methods For Promoting Wound Healing And Tissue Regeneration www.docstoc.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500328481 48 7770165 7770213 8421504 1 48 0 p 350032848100015009 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2004 0 HOXB4 644 chr01q 7770165 7770213 3500328352 48 7770165 7770213 8421504 1 48 0 p 350032835200015005 0-48 Trans-membrane-antibody induced inhibition of apoptosis Brown 2005 0 HOXB4 644 chr01q 7770165 7770213 3500327955 48 7770165 7770213 8421504 1 48 0 p 350032795500015104,350032795500015105 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung (Patent DE:60106423) Findeis 2005 0 HOXB4 644 chr01q 7770165 7770213 3500327712 48 7770165 7770213 8421504 1 48 0 p 350032771200015008,350032771200015000 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung Anti-inflammatory compounds, and their use (Patent DE:60123041) GHOSH 2007 0 HOXB4 644 chr01q 7770165 7770213 3500325895 48 7770165 7770213 8421504 1 48 0 p 350032589500015000 0-48 ACTIVATION OF INNATE IMMUNITY FOR NUCLEAR REPROGRAMMING OF SOMATIC CELLS Cooke 2013 0 HOXB4 644 chr01q 7770165 7770213 3500324849 48 7770165 7770213 8421504 1 48 0 p 350032484900015011 0-48 Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells Chen 2005 0 MIR615 644 chr01q 7770165 7770213 3500324644 48 7770165 7770213 8421504 1 48 0 p 350032464400015000 3-51 19282837 10.1038/jid.2009.49 0022-202X Journal of Investigative Dermatology Bcl-3 Acts as an Innate Immune Modulator by Controlling Antimicrobial Responses in Keratinocytes Buchau 2009 6 MIR615 644 chr01q 7770165 7770213 3500321661 48 7770165 7770213 8421504 1 48 0 p 350032166100015005 0-48 Therapeutic Compositions Manoharan 2010 0 HOXB5 644 chr01q 7770165 7770213 3500318300 48 7770165 7770213 8421504 1 48 0 p 350031830000015053 0-48 COMPOSITIONS AND METHODS FOR MODULATING NOD-LIKE RECEPTOR ACTIVITY AND USES THEREOF - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500316598 48 7770165 7770213 8421504 1 48 0 p 350031659800015003,350031659800015005 39-87,0-48 用于递送治疗剂的新型脂质和组合物 For the delivery of therapeutic agents and compositions of novel lipid Kai Lan Tuo Ta Ti Er *G*La Ji Fu 2011 0 MIR615 644 chr01q 7770165 7770213 3500316176 48 7770165 7770213 8421504 1 48 0 p 350031617600015035 0-48 Screening and therapeutic method for nsclc targeting the cdca8-aurkb complex Daigo 2008 0 HOXB5 644 chr01q 7770165 7770213 3500315135 48 7770165 7770213 8421504 1 48 0 p 350031513500015035 0-48 Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders Bedi 2009 0 HOXB5 644 chr01q 7770165 7770213 3500315070 48 7770165 7770213 8421504 1 48 0 p 350031507000015012 0-48 2-F MODIFIED RNA INTERFERENCE AGENTS - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500314426 48 7770165 7770213 8421504 1 48 0 p 350031442600015000 0-48 TBC1D7 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR CANCER - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500313912 48 7770165 7770213 8421504 1 48 0 p 350031391200015005 0-48 Synthetic lipid rafts and methods of use Khan 2007 0 HOXC6 644 chr01q 7770165 7770213 3500306786 48 7770165 7770213 8421504 1 48 0 p 350030678600015017 0-48 Cell-killing molecules and methods of use thereof Larrick 2004 0 HOXB5 644 chr01q 7770165 7770213 3500306510 48 7770165 7770213 8421504 1 48 0 p 350030651000015002 0-48 Application # 2012/0136042. CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - Patents.com patents.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500301507 48 7770165 7770213 8421504 1 48 0 p 350030150700015009 0-48 Hemangio-colony forming cells Lanza 2008 0 HOXC6 644 chr01q 7770165 7770213 3500295035 48 7770165 7770213 8421504 1 48 0 p 350029503500015000,350029503500015002 0-48,0-48 TheApolipoproteinE-MimeticPeptideCOG112Inhibits BSignaling,ProinflammatoryCytokineExpression,and DiseaseActivityinMurineModelsofColitis S www.jbc.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500294875 48 7770165 7770213 8421504 1 48 0 p 350029487500015007 0-48 PHOSPHOROTHIOATE OLIGONUCLEOTIDES AND NON-NUCLEOSIDIC PHOSPHOROTHIOATES AS DELIVERY AGENTS FOR iRNA AGENTS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500294824 48 7770165 7770213 8421504 1 48 0 p 350029482400015011 0-48 Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500293679 48 7770165 7770213 8421504 1 48 0 p 350029367900015009 0-48 LIPID FORMULATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500293397 48 7770165 7770213 8421504 1 48 0 p 350029339700015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500293383 48 7770165 7770213 8421504 1 48 0 p 350029338300015000 0-48 22676333 10.1186/1756-0500-5-268 BMC Research Notes Ribozyme-mediated gene knock down strategy to dissect the consequences of PDGF stimulation in vascular smooth muscle cells Caterina 2012 0 HOXB4 644 chr01q 7770165 7770213 3500293304 48 7770165 7770213 8421504 1 48 0 p 350029330400015007 0-48 MODIFIED MOLECULAR BEACONS - GEORGIA TECH RESEARCH CORPORATION www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500292474 48 7770165 7770213 8421504 1 48 0 p 350029247400015009 0-48 NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500291281 48 7770165 7770213 8421504 1 48 0 p 350029128100015005 0-48 Pharmaceutical Composition for Treating Autoimmune, Allergic and Inflammatory Diseases and Delivery Method Thereof Lee 2010 0 HOXB4 644 chr01q 7770165 7770213 3500285212 48 7770165 7770213 8421504 1 48 0 p 350028521200015009 0-48 11102469 0270-6474 The Journal of Neuroscience GABAC Receptor Sensitivity Is Modulated by Interaction with MAP1B Billups 2000 7 HOXB4 644 chr01q 7770165 7770213 3500285062 48 7770165 7770213 8421504 1 48 0 p 350028506200015004 0-48 Method for introducing a pna molecule conjugated to a positively charged peptide into the cytosol and/or the nucleus by photochemical internalisation (pci) Boee 2006 0 HOXB4 644 chr01q 7770165 7770213 3500284191 48 7770165 7770213 8421504 1 48 0 p 350028419100015001 0-48 10.1182/blood-2006-07-034009 Blood Caveolin-1 regulates expression of junction-associated proteins in brain microvascular endothelial cells Li 2007 0 HOXB4 644 chr01q 7770165 7770213 3500282320 48 7770165 7770213 8421504 1 48 0 p 350028232000015001 0-48 INDUCED PLURIPOTENT STEM CELLS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500281646 48 7770165 7770213 8421504 1 48 0 p 350028164600015013 0-48 Patent 靶向线粒体的抗肿瘤剂 (Patent CN:101854955) Jiang Bing Xian 2012 0 HOXB4 644 chr01q 7770165 7770213 3500280799 48 7770165 7770213 8421504 1 48 0 p 350028079900015006 0-48 Toxin compounds with enhanced membrane translocation characteristics Aoki 2006 0 HOXB4 644 chr01q 7770165 7770213 3500280211 48 7770165 7770213 8421504 1 48 0 p 350028021100015024 0-48 Compositions and methods for modulating nod-like receptor activity and uses thereof Faustin 2011 0 MIR615 644 chr01q 7770165 7770213 3500279235 48 7770165 7770213 8421504 1 48 0 p 350027923500015022 0-48 SureChem - Document - WO/PCT - Patent No. 2008020596 - "TREATING OR PREVENTING CANCERS OVER-EXPRESSING REG4 OR KIAA0101" - Description www.surechem.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500278948 48 7770165 7770213 8421504 1 48 0 p 350027894800015025 0-48 Patent Mitochondria-targeted anti-tumor agents (Patent CN:101854955) Jiang Bing Xian 2012 0 MIR615 644 chr01q 7770165 7770213 3500276741 48 7770165 7770213 8421504 1 48 0 p 350027674100015008 0-48 CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500275686 48 7770165 7770213 8421504 1 48 0 p 350027568600015000 0-48 22676333 10.1186/1756-0500-5-268 1756-0500 BMC Research Notes Ribozyme-mediated gene knock down strategy to dissect the consequences of PDGF stimulation in vascular smooth muscle cells Lande 2012 0 HOXC6 644 chr01q 7770165 7770213 3500275354 48 7770165 7770213 8421504 1 48 0 p 350027535400015009 0-48 LIPID FORMULATION - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500273506 48 7770165 7770213 8421504 1 48 0 p 350027350600015000 36-84 <HTML> <HEAD><TITLE>ae1a$?aaC/aaa|a$?a<<a1aa-a?a1/4aa3aa(r)a1/2ePS1/2ae1ae3 - c1ei1/4 www.j-tokkyo.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500268198 48 7770165 7770213 8421504 1 48 0 p 350026819800015058 0-48 INHIBITORS OF PROTEIN KINASE C ISOFORMS AND USES THEREOF - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500266522 48 7770165 7770213 8421504 1 48 0 p 350026652200015043 0-48 Peptide antiestrogen compositions and methods for treating breast cancer Pietras 2000 0 MIR615 644 chr01q 7770165 7770213 3500266404 48 7770165 7770213 8421504 1 48 0 p 350026640400015011,350026640400015012,350026640400015082,350026640400015081,350026640400015084,350026640400015003 0-48,0-48,18-63,15-60,27-72,0-45 Peptide oligonucleotide conjugates Hanson 2012 0 MIR615 644 chr01q 7770165 7770213 3500266262 48 7770165 7770213 8421504 1 48 0 p 350026626200015009 0-48 Methods and compositions for identifying RNA-binding proteins - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500264566 48 7770165 7770213 8421504 1 48 0 p 350026456600015017 0-48 Cell-killing molecules and methods of use thereof Larrick 2005 0 HOXB4 644 chr01q 7770165 7770213 3500264500 48 7770165 7770213 8421504 1 48 0 p 350026450000015173,350026450000015174,350026450000015175 3-51,3-51,3-48 Anti-inflammatory Compounds And Uses Thereof .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500263859 48 7770165 7770213 8421504 1 48 0 p 350026385900015001 0-48 COMPOSITIONS AND METHODS FOR MODIFYING THE GLYCOSYLATION PATTERN OF A POLYPEPTIDE Rossomando 2011 0 HOXB4 644 chr01q 7770165 7770213 3500259901 48 7770165 7770213 8421504 1 48 0 p 350025990100015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500259558 48 7770165 7770213 8421504 1 48 0 p 350025955800015000 0-48 15536091 10.1074/jbc.M411380200 0021-9258 Journal of Biological Chemistry Fyn Phosphorylates Human MAP-2c on Tyrosine 67 Zamora-Leon 2005 5 HOXB4 644 chr01q 7770165 7770213 3500259447 48 7770165 7770213 8421504 1 48 0 p 350025944700015003 0-48 Vivit polypeptides, therapeutic agent comprising the same, and method of screening for anti-cancer agent Inaki 2007 0 HOXC6 644 chr01q 7770165 7770213 3500257959 48 7770165 7770213 8421504 1 48 0 p 350025795900015085,350025795900015105,350025795900015065 0-48,0-48,0-48 Composition and Methods for Promoting Wound Healing and tissue Regeneration Ghatnekar 2008 0 HOXB5 644 chr01q 7770165 7770213 3500257921 48 7770165 7770213 8421504 1 48 0 p 350025792100015002 3-51 14560006 10.1128/MCB.23.21.7600-7610.2003 0270-7306 Molecular and Cellular Biology Fibroblast Growth Factor 2-Mediated Translational Control of IAPs Blocks Mitochondrial Release of Smac/DIABLO and Apoptosis in Small Cell Lung Cancer Cells Pardo 2003 6 HOXB5 644 chr01q 7770165 7770213 3500257622 48 7770165 7770213 8421504 1 48 0 p 350025762200015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiolog Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXB5 644 chr01q 7770165 7770213 3500257107 48 7770165 7770213 8421504 1 48 0 p 350025710700015012,350025710700015011,350025710700015003,350025710700015081,350025710700015082,350025710700015084 0-48,0-48,0-45,15-60,18-63,27-72 Peptide oligonucleotide conjugates Hanson 2012 0 MIR615 644 chr01q 7770165 7770213 3500256607 48 7770165 7770213 8421504 1 48 0 p 350025660700015002 0-48 Patent Carbohydrate conjugates as delivery agents for oligonucleotides (Patent US:8106022) Manoharan 2012 0 HOXB4 644 chr01q 7770165 7770213 3500255463 48 7770165 7770213 8421504 1 48 0 p 350025546300015002,350025546300015005 0-48,0-48 10454568 0270-7306 Molecular and Cellular Biology Grb10, a Positive, Stimulatory Signaling Adapter in Platelet-Derived Growth Factor BB-, Insulin-Like Growth Factor I-, and Insulin-Mediated Mitogenesis Wang 1999 6 644 chr01q 7770165 7770213 3500254638 48 7770165 7770213 8421504 1 48 0 p 350025463800015002 0-48 Secretion System and Methods for its Use - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500254081 48 7770165 7770213 8421504 1 48 0 p 350025408100015034,350025408100015101 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Gourdie 2009 0 MIR615 644 chr01q 7770165 7770213 3500248458 48 7770165 7770213 8421504 1 48 0 p 350024845800015034,350024845800015101 0-48,0-48 Patent Compositions and methods for promoting wound healing and tissue regeneration (Patent US:7888319) Ghatnekar 2011 0 MIR615 644 chr01q 7770165 7770213 3500246174 48 7770165 7770213 8421504 1 48 0 p 350024617400015075 0-48 Chimeric peptides including a penetrating peptide and a binding domain of pp2a catalytic subunit to caspase-9 Decaudin 2012 0 MIR615 644 chr01q 7770165 7770213 3500245057 48 7770165 7770213 8421504 1 48 0 p 350024505700015001 0-48 Controlling gene expression in plastids Muehlbauer 2005 0 MIR615 644 chr01q 7770165 7770213 3500243302 48 7770165 7770213 8421504 1 48 0 p 350024330200015006 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING CDCA1-KNTC2 COMPLEX - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500242047 48 7770165 7770213 8421504 1 48 0 p 350024204700015001 0-48 Proteínas recombinantes ligadas a TAT e sua aplicação terapêutica na reversão de dano isquêmico de ilhotas pancreáticas: impacto em transplante bdtd.bce.unb.br 0 0 HOXB4 644 chr01q 7770165 7770213 3500239691 48 7770165 7770213 8421504 1 48 0 p 350023969100015001 3-51 Patent Inhibition of NF-κB activation by blockade of IKKβ-NEMO interactions at the NEMO binding domain (Patent US:6864355) Ghosh 2005 0 HOXB4 644 chr01q 7770165 7770213 3500239523 48 7770165 7770213 8421504 1 48 0 p 350023952300015000 0-48 19006449 10.1089/oli.2008.0152 Oligonucleotides Immunological Response to Peptide Nucleic Acid and its Peptide Conjugate Targeted to Transactivation Response (TAR) Region of HIV-1 RNA Genome Alok 2008 0 HOXB4 644 chr01q 7770165 7770213 3500237127 48 7770165 7770213 8421504 1 48 0 p 350023712700015009 0-48 Hemangio-colony forming cells Lanza 2007 0 MIR615 644 chr01q 7770165 7770213 3500236863 48 7770165 7770213 8421504 1 48 0 p 350023686300015001 3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:8217138) Ghosh 2012 0 MIR615 644 chr01q 7770165 7770213 3500233517 48 7770165 7770213 8421504 1 48 0 p 350023351700015002 0-48 Bacteriophage preparation for the treatment of intracellular bacterial infection Pasechnik 2003 0 HOXB4 644 chr01q 7770165 7770213 3500231908 48 7770165 7770213 8421504 1 48 0 p 350023190800015019,350023190800015051 30-78,0-48 Patent Inhibitions of the interaction between p53 and mdm2 (Patent EP:0958305) BOTTGER 2008 0 HOXB4 644 chr01q 7770165 7770213 3500231526 48 7770165 7770213 8421504 1 48 0 p 350023152600015002 0-48 INHIBITION OF INFLAMMATION USING ANTAGONISTS OF MUC1 - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500230941 48 7770165 7770213 8421504 1 48 0 p 350023094100015000 0-48 Treating or preventing cancers over-expressing reg4 or kiaa0101 Nakagawa 2008 0 HOXC6 644 chr01q 7770165 7770213 3500229598 48 7770165 7770213 8421504 1 48 0 p 350022959800015005,350022959800015020 0-48,0-45 ALGAL TRANSFORMATION SYSTEMS, COMPOSITIONS AND METHODS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500228854 48 7770165 7770213 8421504 1 48 0 p 350022885400015014 0-48 SITE-SPECIFIC DELIVERY OF NUCLEIC ACIDS BY COMBINING TARGETING LIGANDS WITH ENDOSOMOLYTIC COMPONENTS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500227230 48 7770165 7770213 8421504 1 48 0 p 350022723000015003 0-48 COMPOSITIONS AND METHODS FOR DIAGNOSING AUTISM Millonig 2013 0 HOXB4 644 chr01q 7770165 7770213 3500226091 48 7770165 7770213 8421504 1 48 0 p 350022609100015038,350022609100015067 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Gourdie 2011 0 HOXB4 644 chr01q 7770165 7770213 3500225366 48 7770165 7770213 8421504 1 48 0 p 350022536600015010 0-48 Patent Methods and compositions for delivering polynucleotides (Patent US:8039587) Khan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500218975 48 7770165 7770213 8421504 1 48 0 p 350021897500015003 0-48 Patent Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring (Patent US:7459145) Bao 2008 0 HOXC6 644 chr01q 7770165 7770213 3500218826 48 7770165 7770213 8421504 1 48 0 p 350021882600015073 0-48 Targeted immunogens Barber 2003 0 HOXC6 644 chr01q 7770165 7770213 3500217946 48 7770165 7770213 8421504 1 48 0 p 350021794600015005 0-48 TRANS-MEMBRANE-ANTIBODY INDUCED INHIBITION OF APOPTOSIS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500216592 48 7770165 7770213 8421504 1 48 0 p 350021659200015000 0-48 TTK AS TUMOR MARKER AND THERAPEUTIC TARGET FOR LUNG CANCER - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500216564 48 7770165 7770213 8421504 1 48 0 p 350021656400015000 0-48 21402890 10.4049/jimmunol.1002424 0022-1767 The Journal of Immunology Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface Toshchakov 2011 6 MIR615 644 chr01q 7770165 7770213 3500215589 48 7770165 7770213 8421504 1 48 0 p 350021558900015000 0-48 19961612 10.1186/1742-4690-6-112 1742-4690 Retrovirology Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal Levin 2009 6 HOXB5 644 chr01q 7770165 7770213 3500214662 48 7770165 7770213 8421504 1 48 0 p 350021466200015001 0-48 Controlling gene expression in plastids Muehlbauer 2005 0 HOXC6 644 chr01q 7770165 7770213 3500213268 48 7770165 7770213 8421504 1 48 0 p 350021326800015002 0-48 PEPTIDES TARGETED TO PROTEIN KINASE C ISOFORMS AND USES THEREOF - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500213265 48 7770165 7770213 8421504 1 48 0 p 350021326500015009,350021326500015016 0-48,18-66 MicroRNA Antisense PNAs, Compositions Comprising the Same, and Methods for Using and Evaluating the Same Oh 2010 0 MIR615 644 chr01q 7770165 7770213 3500211965 48 7770165 7770213 8421504 1 48 0 p 350021196500015010 0-48 Immunogenic Polypeptides and Monoclonal Antibodies - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500211732 48 7770165 7770213 8421504 1 48 0 p 350021173200015005 0-48 主题：Nuclear | 医源世界 www.39kf.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500209792 48 7770165 7770213 8421504 1 48 0 p 350020979200015030 0-48 Compositions and methods of use of targeting peptides against placenta and adipose tissues osdir.com/patents 0 0 HOXC6 644 chr01q 7770165 7770213 3500208092 48 7770165 7770213 8421504 1 48 0 p 350020809200015019,350020809200015020 3-51,0-48 Molecular vaccine linking intercellular spreading protein to an antigen Wu 2003 0 HOXB4 644 chr01q 7770165 7770213 3500208064 48 7770165 7770213 8421504 1 48 0 p 350020806400015012 0-48 COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY Cui 2007 0 HOXB4 644 chr01q 7770165 7770213 3500207888 48 7770165 7770213 8421504 1 48 0 p 350020788800015000 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2003 0 HOXB4 644 chr01q 7770165 7770213 3500206127 48 7770165 7770213 8421504 1 48 0 p 350020612700015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiology Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXC6 644 chr01q 7770165 7770213 3500202479 48 7770165 7770213 8421504 1 48 0 p 350020247900015001 0-48 Double-stranded oligonucleotides Wiederholt 2003 0 MIR615 644 chr01q 7770165 7770213 3500201468 48 7770165 7770213 8421504 1 48 0 p 350020146800015016 0-48 Immunogenic Polypeptides and Monoclonal Antibodies Ochs 2012 0 HOXB5 644 chr01q 7770165 7770213 3500200898 48 7770165 7770213 8421504 1 48 0 p 350020089800015009 0-48 Lipid formulation Chen 2010 0 HOXC6 644 chr01q 7770165 7770213 3500200892 48 7770165 7770213 8421504 1 48 0 p 350020089200015004 0-48 Fusion proteins for the treatment of CNS Gruskin 2004 0 HOXC6 644 chr01q 7770165 7770213 3500200713 48 7770165 7770213 8421504 1 48 0 p 350020071300015012,350020071300015015,350020071300015009,350020071300015010 0-48,0-48,0-48,0-48 Disheveled pdz modulators Costa 2010 0 644 chr01q 7770165 7770213 3500199113 48 7770165 7770213 8421504 1 48 0 p 350019911300015000,350019911300015001 9-57,9-57 17347452 10.1152/ajpgi.00273.2006 American Journal of Physiology - Gastrointestinal and Liver Physiology Ethanol induced NF-κB activation protects against cell injury in cultured rat gastric mucosal epithelium Mustonen 2007 0 HOXC6 644 chr01q 7770165 7770213 3500197411 48 7770165 7770213 8421504 1 48 0 p 350019741100015125 0-48 HUMAN AND MOUSE TARGETING PEPTIDES IDENTIFIED BY PHAGE DISPLAY Arap 2011 0 HOXB4 644 chr01q 7770165 7770213 3500196917 48 7770165 7770213 8421504 1 48 0 p 350019691700015001,350019691700015000 60-108,60-108 Cyclin D1 Regulates Cellular Migration through the Inhibition of Thrombospondin 1 and ROCK Signaling mcb.asm.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500196713 48 7770165 7770213 8421504 1 48 0 p 350019671300015002 0-48 10.5772/55518 978-953-51-1014-9 Gene Therapy - Tools and Potential Applications Ian 2013 0 HOXB4 644 chr01q 7770165 7770213 3500196159 48 7770165 7770213 8421504 1 48 0 p 350019615900015018,350019615900015022 0-48,0-45 Interaction Between the VHL Tumour Suppressor and Hypoxia Inducible Factor, and Assay Methods Relating Thereto - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500196068 48 7770165 7770213 8421504 1 48 0 p 350019606800015004 0-48 FACTOR Maden 2009 0 HOXB4 644 chr01q 7770165 7770213 3500193251 48 7770165 7770213 8421504 1 48 0 p 350019325100015001 0-48 TTK AS TUMOR MARKER AND THERAPEUTIC TARGET FOR LUNG CANCER Nakamura 2007 0 MIR615 644 chr01q 7770165 7770213 3500192444 48 7770165 7770213 8421504 1 48 0 p 350019244400015000 0-48 22510693 10.1038/ncomms1773 2041-1733 Nature Communications Combinatorial targeting and discovery of ligand-receptors in organelles of mammalian cells Rangel 2012 0 MIR615 644 chr01q 7770165 7770213 3500191638 48 7770165 7770213 8421504 1 48 0 p 350019163800015086 0-48 Compositions and methods of use of targeting peptides against placenta and adipose tissues Pasqualini 2002 0 MIR615 644 chr01q 7770165 7770213 3500191320 48 7770165 7770213 8421504 1 48 0 p 350019132000015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500190261 48 7770165 7770213 8421504 1 48 0 p 350019026100015001 0-48 22913813 10.1186/1476-4598-11-59 1476-4598 Molecular Cancer Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells Horibe 2012 4 HOXC6 644 chr01q 7770165 7770213 3500188425 48 7770165 7770213 8421504 1 48 0 p 350018842500015003 0-48 CYCLIC DI-AMP INDUCTION OF TYPE I INTERFERON Portnoy 2011 0 HOXB4 644 chr01q 7770165 7770213 3500183031 48 7770165 7770213 8421504 1 48 0 p 350018303100015000 0-48 Screening method of anti-lung or esophageal cancer compounds Daigo 2011 0 HOXC6 644 chr01q 7770165 7770213 3500180627 48 7770165 7770213 8421504 1 48 0 p 350018062700015010 0-48 ＶＨＬ腫瘍サプレッサーと低酸素誘導因子との相互作用、およびそれに astamuse.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500180482 48 7770165 7770213 8421504 1 48 0 p 350018048200015004 0-48 Methods and compositions for delivering polynucleotides Khan 2005 0 HOXB4 644 chr01q 7770165 7770213 3500179659 48 7770165 7770213 8421504 1 48 0 p 350017965900015002 0-48 Factor Maden 2007 0 HOXC6 644 chr01q 7770165 7770213 3500177658 48 7770165 7770213 8421504 1 48 0 p 350017765800015000,350017765800015001 3-51,3-51 20139273 10.4049/jimmunol.0903133 0022-1767 The Journal of Immunology IL-17 Activates the Canonical NF-κB Signaling Pathway in Autoimmune B Cells of BXD2 Mice To Upregulate the Expression of Regulators of G-Protein Signaling 16 Xie 2010 6 HOXB4 644 chr01q 7770165 7770213 3500175950 48 7770165 7770213 8421504 1 48 0 p 350017595000015013 0-48 Compositions And Methods For The Delivery Of Biologically Active RNAs - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500175345 48 7770165 7770213 8421504 1 48 0 p 350017534500015014 0-48 Genetically Intact Induced Pluripotent Cells Or Transdifferentiated Cells And Methods For The Production Thereof Klimanskaya 2010 0 HOXB4 644 chr01q 7770165 7770213 3500172898 48 7770165 7770213 8421504 1 48 0 p 350017289800015006 0-48 Treatment of cancer via targeting of il-13 receptor-alpha2 Strober 2011 0 MIR615 644 chr01q 7770165 7770213 3500170470 48 7770165 7770213 8421504 1 48 0 p 350017047000015003 0-48 A highly effective and long-lasting inhibition of miRNAs with PNA-based antisense oligonucleotides. - ResearchGate .researchgate.net 0 0 HOXB4 644 chr01q 7770165 7770213 3500168461 48 7770165 7770213 8421504 1 48 0 p 350016846100015000 0-48 Peptides targeted to protein kinase C isoforms and uses thereof Phipps 2011 0 HOXC6 644 chr01q 7770165 7770213 3500166999 48 7770165 7770213 8421504 1 48 0 p 350016699900015013 0-48 Nonviral vectors for delivering polynucleotides Khan 2006 0 HOXB4 644 chr01q 7770165 7770213 3500165478 48 7770165 7770213 8421504 1 48 0 p 350016547800015005 0-48 Compositions And Methods For Detecting And Treating Hiv Infections .freshpatents.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500162909 48 7770165 7770213 8421504 1 48 0 p 350016290900015007 0-48 Modified iRNA agents Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500160787 48 7770165 7770213 8421504 1 48 0 p 350016078700015005 0-48 TOXIN COMPOUNDS WITH ENHANCED MEMBRANE TRANSLOCATION CHARACTERISTICS Fernandez-salas 2008 0 HOXB4 644 chr01q 7770165 7770213 3500160610 48 7770165 7770213 8421504 1 48 0 p 350016061000015004 0-48 METHOD FOR TREATING OR PREVENTING BLADDER CANCER USING THE DEPDC1 POLYPEPTIDE Nakamura 2009 0 HOXB4 644 chr01q 7770165 7770213 3500158535 48 7770165 7770213 8421504 1 48 0 p 350015853500015002 0-48 Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof Lee 2008 0 HOXB5 644 chr01q 7770165 7770213 3500157819 48 7770165 7770213 8421504 1 48 0 p 350015781900015002 0-48 Oligonucleotide Compositions with Enhanced Efficiency Woolf 2009 0 HOXB4 644 chr01q 7770165 7770213 3500157203 48 7770165 7770213 8421504 1 48 0 p 350015720300015004 0-48 Perde1588292657 www.scribd.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500154541 48 7770165 7770213 8421504 1 48 0 p 350015454100015025 0-48 Patent Peptide antiestrogen compositions and methods for treating breast cancer (Patent US:6306832) Pietras 2001 0 HOXB4 644 chr01q 7770165 7770213 3500150181 48 7770165 7770213 8421504 1 48 0 p 350015018100015019 0-48 CHEMICALLY MODIFIED OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500148476 48 7770165 7770213 8421504 1 48 0 p 350014847600015034,350014847600015033,350014847600015032 0-48,0-48,0-48 TARGETING OF EWS-FLI1 AS ANTI-TUMOR THERAPY Toretsky 2009 0 HOXB4 644 chr01q 7770165 7770213 3500147023 48 7770165 7770213 8421504 1 48 0 p 350014702300015003,350014702300015002 0-48,6-54 Agent for inhibiting development or progress of proliferative diseases and especially cancer diseases and pharmaceutical composition containing said agent Juping 2005 0 HOXB4 644 chr01q 7770165 7770213 3500142737 48 7770165 7770213 8421504 1 48 0 p 350014273700015003 0-48 TREATING OR PREVENTING CANCERS OVER-EXPRESSING REG4 OR KIAA0101 - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500140678 48 7770165 7770213 8421504 1 48 0 p 350014067800015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500139233 48 7770165 7770213 8421504 1 48 0 p 350013923300015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7538211) Benedict 2009 0 HOXB4 644 chr01q 7770165 7770213 3500139027 48 7770165 7770213 8421504 1 48 0 p 350013902700015014 0-48 Erap1由来ペプチド及びその使用 Katagiri 2013 0 HOXB4 644 chr01q 7770165 7770213 3500138929 48 7770165 7770213 8421504 1 48 0 p 350013892900015002,350013892900015136 0-48,0-45 Secretion System and Methods for its Use - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500138711 48 7770165 7770213 8421504 1 48 0 p 350013871100015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500138434 48 7770165 7770213 8421504 1 48 0 p 350013843400015012,350013843400015011,350013843400015017,350013843400015014 0-48,0-48,0-48,0-48 DISHEVELED PDZ MODULATORS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500136130 48 7770165 7770213 8421504 1 48 0 p 350013613000015009 0-48 MICELLIC ASSEMBLIES - UNIVERSITY OF WASHINGTON www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500132886 48 7770165 7770213 8421504 1 48 0 p 350013288600015006 0-48 MODIFIED iRNA AGENTS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500132386 48 7770165 7770213 8421504 1 48 0 p 350013238600015006,350013238600015020,350013238600015011 0-48,0-48,0-48 散乱蛋白pdz调节剂 Zhang Ying Nan 2009 0 644 chr01q 7770165 7770213 3500130575 48 7770165 7770213 8421504 1 48 0 p 350013057500015008 0-48 IMMUNOGENIC POLYPEPTIDES AND MONOCLONAL ANTIBODIES - Sanofi Pasteur Limited www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500127918 48 7770165 7770213 8421504 1 48 0 p 350012791800015000 0-48 Patent PNA conjugate for the treatment of diseases associated with HIV (Patent US:7563761) Braun 2009 0 MIR615 644 chr01q 7770165 7770213 3500127054 48 7770165 7770213 8421504 1 48 0 p 350012705400015005 0-48 Therapeutic compositions Manoharan 2013 0 HOXC6 644 chr01q 7770165 7770213 3500126353 48 7770165 7770213 8421504 1 48 0 p 350012635300015004 0-48 Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring Bao 2003 0 MIR615 644 chr01q 7770165 7770213 3500125474 48 7770165 7770213 8421504 1 48 0 p 350012547400015011,350012547400015012,350012547400015003,350012547400015084,350012547400015082,350012547400015081 0-48,0-48,0-45,27-72,18-63,15-60 PEPTIDE OLIGONUCLEOTIDE CONJUGATES - AVI BIOPHARMA, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500124891 48 7770165 7770213 8421504 1 48 0 p 350012489100015004 0-48 16822931 10.1124/mol.105.021741 1521-0111 (Online) Molecular Pharmacology Caveolin-1 Regulates Store-Operated Ca2+ Influx by Binding of Its Scaffolding Domain to Transient Receptor Potential Channel-1 in Endothelial Cells Kwiatek 2006 0 HOXB4 644 chr01q 7770165 7770213 3500122903 48 7770165 7770213 8421504 1 48 0 p 350012290300015013 0-48 20934997 10.3324/haematol.2010.030924 0390-6078 Haematologica The impact of human leukocyte antigen (HLA) micropolymorphism on ligand specificity within the HLA-B*41 allotypic family Bade-Doding 2011 6 HOXB4 644 chr01q 7770165 7770213 3500120941 48 7770165 7770213 8421504 1 48 0 p 350012094100015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiolog Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXB4 644 chr01q 7770165 7770213 3500119318 48 7770165 7770213 8421504 1 48 0 p 350011931800015005 0-48 Patent Therapeutic compositions (Patent US:8445665) Manoharan 2013 0 HOXB4 644 chr01q 7770165 7770213 3500117014 48 7770165 7770213 8421504 1 48 0 p 350011701400015123 0-48 Patent Peptide compositions for targeting adipose tissue (Patent US:8067377) Arap 2011 0 HOXB4 644 chr01q 7770165 7770213 3500116776 48 7770165 7770213 8421504 1 48 0 p 350011677600015000,350011677600015001 0-48,0-48 20427663 10.1523/JNEUROSCI.5094-09.2010 0270-6474 The Journal of Neuroscience Dysregulation of Dopamine Transporters via Dopamine D2 Autoreceptors Triggers Anomalous Dopamine Efflux Associated with Attention-Deficit Hyperactivity Disorder Bowton 2010 7 HOXC6 644 chr01q 7770165 7770213 3500114543 48 7770165 7770213 8421504 1 48 0 p 350011454300015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500113737 48 7770165 7770213 8421504 1 48 0 p 350011373700015001 0-48 主题：CD40 | 医源世界 www.39kf.com 0 0 MIR615 644 chr01q 7770165 7770213 3500111505 48 7770165 7770213 8421504 1 48 0 p 350011150500015007,350011150500015000 3-51,3-51 Voltage dependent anion channel (vdac1) compositions and methods of use thereof for regulating apoptosis Shoshan-Barmatz 2011 0 HOXC6 644 chr01q 7770165 7770213 3500110810 48 7770165 7770213 8421504 1 48 0 p 350011081000015001,350011081000015000 3-51,3-51 TLR2-dependenteosinophilinteractionswithmycobacteria:roleof -defensins tologylibrary.org 0 0 MIR615 644 chr01q 7770165 7770213 3500110086 48 7770165 7770213 8421504 1 48 0 p 350011008600015000 0-48 Patent Pna conjugate for the treatment of diseases associated with hiv (Patent EP:1404373) Braun 2008 0 HOXC6 644 chr01q 7770165 7770213 3500109228 48 7770165 7770213 8421504 1 48 0 p 350010922800015008,350010922800015009 0-48,63-111 12138200 10.1128/MCB.22.16.5897-5911.2002 0270-7306 Molecular and Cellular Biology Site-Directed Perturbation of Protein Kinase C- Integrin Interaction Blocks Carcinoma Cell Chemotaxis Parsons 2002 6 HOXC6 644 chr01q 7770165 7770213 3500108397 48 7770165 7770213 8421504 1 48 0 p 350010839700015005 0-48 Methods and compositions for delivering polynucleotides Khan 2006 0 HOXB5 644 chr01q 7770165 7770213 3500106573 48 7770165 7770213 8421504 1 48 0 p 350010657300015000 0-48 Enhanced efficiency of induced pluripotent stem cell generation - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500106421 48 7770165 7770213 8421504 1 48 0 p 350010642100015093,350010642100015100 3-51,0-48 ISOZYME-SPECIFIC ANTAGONISTS OF PROTEIN KINASE C - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500105384 48 7770165 7770213 8421504 1 48 0 p 350010538400015006 0-48 Activatable toxin complexes comprising a cleavable inhibitory peptide Benhar 2012 0 HOXB4 644 chr01q 7770165 7770213 3500103084 48 7770165 7770213 8421504 1 48 0 p 350010308400015039,350010308400015071 0-48,0-48 ALPHA CONNEXIN C-TERMINAL (ACT) PEPTIDES FOR TREATING AGE-RELATED MACULAR DEGENERATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500102288 48 7770165 7770213 8421504 1 48 0 p 350010228800015005,350010228800015010 0-48,0-45 Antisense compounds which prevent cell death and uses thereof Troy 1997 0 HOXB4 644 chr01q 7770165 7770213 3500101924 48 7770165 7770213 8421504 1 48 0 p 350010192400015000 0-48 Control of apoptosis using a complex of an oligonucleotide and a regulatory peptide Jenkinson 2004 0 HOXB4 644 chr01q 7770165 7770213 3500101748 48 7770165 7770213 8421504 1 48 0 p 350010174800015007,350010174800015006,350010174800015005,350010174800015000,350010174800015009,350010174800015008 3-51,3-51,3-51,3-51,3-51,3-51 VOLTAGE DEPENDENT ANION CHANNEL (VDACl) COMPOSITIONS AND METHODS OF USE THEREOF FOR REGULATING APOPTOSIS Shoshan-Barmatz 2006 0 HOXB4 644 chr01q 7770165 7770213 3500101536 48 7770165 7770213 8421504 1 48 0 p 350010153600015000,350010153600015005 0-48,6-51 Pna-konjugat zur therapie von mit hiv in zusammenhang stehenden erkrankungen Braun 2004 0 HOXB4 644 chr01q 7770165 7770213 3500100804 48 7770165 7770213 8421504 1 48 0 p 350010080400015003 0-48 METHOD OF TREATING NEURODEGENERATIVE DISEASE - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500100085 48 7770165 7770213 8421504 1 48 0 p 350010008500015002 0-48 Targeting the BCL9/B9L Binding Interaction with β-catenin as a Potential Anticancer Strategy by Steven Akira Kawamoto lue.lib.umich.edu 0 0 HOXB4 644 chr01q 7770165 7770213 3500100022 48 7770165 7770213 8421504 1 48 0 p 350010002200015032 0-48 Peptide-dicer substrate rna conjugates as delivery vehicles for sirna Ahmadian 2007 0 HOXB4 644 chr01q 7770165 7770213 3500099731 48 7770165 7770213 8421504 1 48 0 p 350009973100015000 0-48 Patent Pna-konjugat zur therapie von mit hiv in zusammenhang stehenden erkrankungen (Patent EP:1404373) Braun 2008 0 HOXB4 644 chr01q 7770165 7770213 3500099421 48 7770165 7770213 8421504 1 48 0 p 350009942100015001,350009942100015000 15-63,18-66 GENE AMPLIFICATION OF COACTIVATOR COAA AND USES THEREOF - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500096913 48 7770165 7770213 8421504 1 48 0 p 350009691300015065,350009691300015105,350009691300015085 0-48,0-48,0-48 Patent Composition and methods for promoting wound healing and tissue regeneration (Patent US:7786074) Ghatnekar 2010 0 HOXB4 644 chr01q 7770165 7770213 3500096451 48 7770165 7770213 8421504 1 48 0 p 350009645100015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7803931) Benedict 2010 0 HOXC6 644 chr01q 7770165 7770213 3500096113 48 7770165 7770213 8421504 1 48 0 p 350009611300015006 0-48 ALGAL TRANSFORMATION SYSTEMS, COMPOSITIONS AND METHODS Macmillan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500090044 48 7770165 7770213 8421504 1 48 0 p 350009004400015001 0-48 DOI: 10.1093/nar/gkg160 Cellular uptake of Antennapedia Penetratin peptides is a two-step process in which phase transfer precedes a tryptophan-dependent translocation ww.farm.ucl.ac.be 0 0 MIR615 644 chr01q 7770165 7770213 3500089187 48 7770165 7770213 8421504 1 48 0 p 350008918700015004 0-48 Methods and compositions for delivering polynucleotides Khan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500087478 48 7770165 7770213 8421504 1 48 0 p 350008747800015000 0-48 Cell cycle progression proteins Deak 2003 0 HOXB4 644 chr01q 7770165 7770213 3500084148 48 7770165 7770213 8421504 1 48 0 p 350008414800015002 0-48 COMPOSITIONS AND METHODS FOR DETECTING AND TREATING HIV INFECTIONS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500079904 48 7770165 7770213 8421504 1 48 0 p 350007990400015036,350007990400015102 0-48,0-48 COMPOSITIONS AND METHODS FOR PROMOTING WOUND HEALING AND TISSUE REGENERATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500079348 48 7770165 7770213 8421504 1 48 0 p 350007934800015019,350007934800015016 0-48,0-48 靶向线粒体的抗肿瘤剂 Jiang Bing Xian 2010 0 HOXB5 644 chr01q 7770165 7770213 3500078577 48 7770165 7770213 8421504 1 48 0 p 350007857700015127 0-48 Human And Mouse Targeting Peptides Identified By Phage Display .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500075826 48 7770165 7770213 8421504 1 48 0 p 350007582600015006 0-48 TRANSDUCIBLE POLYPEPTIDES FOR MODIFYING METABOLISM - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500074550 48 7770165 7770213 8421504 1 48 0 p 350007455000015000 0-48 Ttk as tumor marker and therapeutic target for lung cancer Daigo 2008 0 HOXB4 644 chr01q 7770165 7770213 3500073937 48 7770165 7770213 8421504 1 48 0 p 350007393700015000 0-48 Patent Nachweisverfahren für peptide Detection method for peptide (Patent DE:69935313) KEES 2007 0 HOXB4 644 chr01q 7770165 7770213 3500073624 48 7770165 7770213 8421504 1 48 0 p 350007362400015055,350007362400015019,350007362400015056 39-87,36-84,0-48 Inhibitors of the interaction between P53 and MDM2 - Patent # 7083983 - PatentGenius .patentgenius.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500073579 48 7770165 7770213 8421504 1 48 0 p 350007357900015004 0-48 Compositons, methods and kits for real-time nucleic acid analysis in live cells - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500072930 48 7770165 7770213 8421504 1 48 0 p 350007293000015001 0-48 16020665 10.1158/1535-7163.MCT-04-0253 1535-7163 Molecular Cancer Therapeutics Application of thermally responsive polypeptides directed against c-Myc transcriptional function for cancer therapy III 2005 5 HOXB4 644 chr01q 7770165 7770213 3500072678 48 7770165 7770213 8421504 1 48 0 p 350007267800015083 0-48 COMPOSITIONS AND METHODS OF USE OF TARGETING PEPTIDES AGAINST PLACENTA AND ADIPOSE TISSUES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500070167 48 7770165 7770213 8421504 1 48 0 p 350007016700015001 0-48 DOUBLE-STRANDED OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500069838 48 7770165 7770213 8421504 1 48 0 p 350006983800015009 0-48 Retinoic acid receptor beta-2, its antagonists, and gene therapy vectors for the treatment of neurological disorders CORCORAN 2003 0 MIR615 644 chr01q 7770165 7770213 3500068922 48 7770165 7770213 8421504 1 48 0 p 350006892200015001 0-48 22913813 10.1186/1476-4598-11-59 Molecular Cancer Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells Tomohisa 2012 0 MIR615 644 chr01q 7770165 7770213 3500067379 48 7770165 7770213 8421504 1 48 0 p 350006737900015002 0-48 Production of Pluripotent Cells Through Inhibition of Bright/Arid3a Function - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500065094 48 7770165 7770213 8421504 1 48 0 p 350006509400015000 0-48 10.1083/jcb.200211081 The Journal of Cell Biology An essential role for hGle1 nucleocytoplasmic shuttling in mRNA export Frederic 2003 0 HOXC6 644 chr01q 7770165 7770213 3500065002 48 7770165 7770213 8421504 1 48 0 p 350006500200015001 0-48 Use of cytidine deaminase-related agents to promote demethylation and cell reprogramming Blau 2011 0 HOXC6 644 chr01q 7770165 7770213 3500063035 48 7770165 7770213 8421504 1 48 0 p 350006303500015001,350006303500015009 0-48,0-45 Double-Stranded Oligonucleotides - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500062703 48 7770165 7770213 8421504 1 48 0 p 350006270300015011 0-48 Di-aliphatic substituted pegylated lipids Manoharan 2013 0 MIR615 644 chr01q 7770165 7770213 3500062415 48 7770165 7770213 8421504 1 48 0 p 350006241500015015 0-48 COMBINATION THERAPIES WITH MITOCHONDRIAL-TARGETED ANTI-TUMOR AGENTS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500061735 48 7770165 7770213 8421504 1 48 0 p 350006173500015014 0-48 CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500061397 48 7770165 7770213 8421504 1 48 0 p 350006139700015018 0-48 Interaction between the vhl tumour suppressor and hypoxia inducible factor, and assay methods relating thereto Maxwell 2000 0 HOXB5 644 chr01q 7770165 7770213 3500059982 48 7770165 7770213 8421504 1 48 0 p 350005998200015001 0-48 15637154 10.1073/pnas.0407224102 0027-8424 Proceedings of the National Academy of Sciences of the United States of America Dissecting the molecular control of endothelial NO synthase by caveolin-1 using cell-permeable peptides Bernatchez 2005 10 HOXC6 644 chr01q 7770165 7770213 3500051201 48 7770165 7770213 8421504 1 48 0 p 350005120100015003 0-48 PROMOTION OF PEROXISOMAL CATALASE FUNCTION IN CELLS Terlecky 2003 0 HOXC6 644 chr01q 7770165 7770213 3500051060 48 7770165 7770213 8421504 1 48 0 p 350005106000015000 0-48 Patent Method for detecting proteinaceous inhibitors of protein-protein or DNA-protein interactions (Patent US:6610495) Watt 2003 0 HOXC6 644 chr01q 7770165 7770213 3500048303 48 7770165 7770213 8421504 1 48 0 p 350004830300015000 0-48 Ttk as tumor marker and therapeutic target for lung cancer Daigo 2009 0 MIR615 644 chr01q 7770165 7770213 3500047773 48 7770165 7770213 8421504 1 48 0 p 350004777300015027 0-48 BLOCKADE OF TL1A-DR3 INTERACTIONS TO AMELIORATE T CELL MEDIATED DISEASE PATHOLOGY - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500047571 48 7770165 7770213 8421504 1 48 0 p 350004757100015013,350004757100015007 18-66,0-48 MicroRNA antisense PNAs, compositions comprising the same, and methods for using and evaluating the same Park 2012 0 HOXB4 644 chr01q 7770165 7770213 3500046544 48 7770165 7770213 8421504 1 48 0 p 350004654400015010 0-48 CELL-BASED BIOPROCESSING - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500046272 48 7770165 7770213 8421504 1 48 0 p 350004627200015004 0-48 NOVEL Aß-BINDING PROTEIN AND ITS PEPTIDE DERIVATIVES AND USES THEREOF - NATIONAL RESEARCH COUNCIL OF CANADA www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500044825 48 7770165 7770213 8421504 1 48 0 p 350004482500015004 0-48 Double-stranded oligonucleotides Woolf 2003 0 HOXB5 644 chr01q 7770165 7770213 3500043198 48 7770165 7770213 8421504 1 48 0 p 350004319800015014 0-48 Genetically Intact Induced Pluripotent Cells Or Transdifferentiated Cells And Methods For The Production Thereof - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500043019 48 7770165 7770213 8421504 1 48 0 p 350004301900015166,350004301900015168 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung Anti-inflammatory compounds, and their use (Patent DE:60106423) Findeis 2005 0 MIR615 644 chr01q 7770165 7770213 3500042770 48 7770165 7770213 8421504 1 48 0 p 350004277000015091,350004277000015098 3-51,0-48 Isozyme-specific antagonists of protein kinase C - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500042218 48 7770165 7770213 8421504 1 48 0 p 350004221800015010 0-48 ERAP1由来ペプチド及びその使用 - IP.com ip.com/patfam/ja/ 0 0 MIR615 644 chr01q 7770165 7770213 3500040558 48 7770165 7770213 8421504 1 48 0 p 350004055800015009 0-48 Hemangio-colony forming cells Lanza 2009 0 MIR615 644 chr01q 7770165 7770213 3500038048 48 7770165 7770213 8421504 1 48 0 p 350003804800015002,350003804800015000 3-51,3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:7538089) May 2009 0 HOXB4 644 chr01q 7770165 7770213 3500038025 48 7770165 7770213 8421504 1 48 0 p 350003802500015001 0-48 Oligonucleotide Compositions with Enhanced Efficiency - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500037875 48 7770165 7770213 8421504 1 48 0 p 350003787500015004 0-48 Improved lipid formulation Akinc 2012 0 HOXB4 644 chr01q 7770165 7770213 3500032841 48 7770165 7770213 8421504 1 48 0 p 350003284100015000,350003284100015001 3-51,3-51 Treatment Of Human Multiple Myeloma By Curcumin .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500032423 48 7770165 7770213 8421504 1 48 0 p 350003242300015001 0-48 23940795 10.1371/journal.pone.0071957 1932-6203 PLOS ONE PLOS ONE: Phosphorylation of the Actin Binding Protein Drebrin at S647 Is Regulated by Neuronal Activity and PTEN Kreis 2013 4 HOXB4 644 chr01q 7770165 7770213 3500030957 48 7770165 7770213 8421504 1 48 0 p 350003095700015004 0-48 Screening and therapeutic method for nsclc targeting cdca1-kntc2 complex Daigo 2007 0 HOXB4 644 chr01q 7770165 7770213 3500030856 48 7770165 7770213 8421504 1 48 0 p 350003085600015005 0-48 Method for detecting proteinaceous inhibitors of protein-protein or DNA-protein interactions Watt 1999 0 HOXB4 644 chr01q 7770165 7770213 3500030768 48 7770165 7770213 8421504 1 48 0 p 350003076800015016,350003076800015019 0-48,0-48 Patent Mitochondria-targeted anti-tumor agents (Patent US:8466140) Altieri 2013 0 HOXB4 644 chr01q 7770165 7770213 3500030630 48 7770165 7770213 8421504 1 48 0 p 350003063000015000,350003063000015003 3-51,3-51 Anti-inflammatory compounds and uses thereof May 2005 0 HOXB4 644 chr01q 7770165 7770213 3500029692 48 7770165 7770213 8421504 1 48 0 p 350002969200015008 0-48 Immunogenic polypeptides and monoclonal antibodies Brookes 2009 0 HOXB4 644 chr01q 7770165 7770213 3500029444 48 7770165 7770213 8421504 1 48 0 p 350002944400015006 39-87 用于递送治疗剂的新型脂质和组合物 Kai Lan Tuo Ta Ti Er *G*La Ji Fu 2011 0 HOXC6 644 chr01q 7770165 7770213 3500029112 48 7770165 7770213 8421504 1 48 0 p 350002911200015000 0-48 Peptides targeted to protein kinase c isoforms and uses thereof Phipps 2010 0 HOXC6 644 chr01q 7770165 7770213 3500026374 48 7770165 7770213 8421504 1 48 0 p 350002637400015000 0-48 TBC1D7 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR CANCER - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500025356 48 7770165 7770213 8421504 1 48 0 p 350002535600015001,350002535600015004 0-48,0-48 International Journal of Medical Sciences www.medsci.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500024469 48 7770165 7770213 8421504 1 48 0 p 350002446900015004 0-48 Erap1-derived peptide and use thereof Katagiri 2013 0 MIR615 644 chr01q 7770165 7770213 3500024102 48 7770165 7770213 8421504 1 48 0 p 350002410200015000 0-48 16301656 0022-1767 The Journal of Immunology Toll-IL-1 Receptor Domain-Containing Adaptor Protein Is Critical for Early Lung Immune Responses against Escherichia coli Lipopolysaccharide and Viable Escherichia coli Jeyaseelan 2005 6 MIR615 644 chr01q 7770165 7770213 3500023336 48 7770165 7770213 8421504 1 48 0 p 350002333600015000 0-48 Immune System Function in Conditions Characterized by Elevated Double Strand Breaks - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500022904 48 7770165 7770213 8421504 1 48 0 p 350002290400015003 0-48 Assays and methods for determining activity of a therapeutic agent in a subject Sah 2012 0 HOXB5 644 chr01q 7770165 7770213 3500022158 48 7770165 7770213 8421504 1 48 0 p 350002215800015010 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING CDCA1-KNTC2 COMPLEX Nakamura 2006 0 MIR615 644 chr01q 7770165 7770213 3500018336 48 7770165 7770213 8421504 1 48 0 p 350001833600015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 MIR615 644 chr01q 7770165 7770213 3500013103 48 7770165 7770213 8421504 1 48 0 p 350001310300015000,350001310300015001 3-51,3-51 18607384 10.1038/ijo.2008.101 0307-0565 International Journal of Obesity Characterization of the human CIDEA promoter in fat cells Pettersson 2008 5 HOXB4 644 chr01q 7770165 7770213 3500011010 48 7770165 7770213 8421504 1 48 0 p 350001101000015007 0-48 Autogene nucleic acids encoding a secretable RNA polymerase Finn 2002 0 HOXB4 644 chr01q 7770165 7770213 3500010947 48 7770165 7770213 8421504 1 48 0 p 350001094700015230,350001094700015229,350001094700015231,350001094700015232 3-51,3-51,0-45,0-45 Anti-inflammatory compounds and uses thereof - Patent # 7049395 - PatentGenius .patentgenius.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500009611 48 7770165 7770213 8421504 1 48 0 p 350000961100015006 0-48 LIGAND-CONJUGATED MONOMERS Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500009575 48 7770165 7770213 8421504 1 48 0 p 350000957500015005 0-48 PNA conjugate for the treatment of diseases associated with HIV Braun 2002 0 HOXC6 644 chr01q 7770165 7770213 3500008929 48 7770165 7770213 8421504 1 48 0 p 350000892900015006 0-48 iRNA conjugates Manoharan 2004 0 HOXB5 644 chr01q 7770165 7770213 3500008841 48 7770165 7770213 8421504 1 48 0 p 350000884100015000 24-72 18283311 10.1038/sj.bjc.6604268 0007-0920 British Journal of Cancer Double inhibition of XIAP and Bcl-2 axis is beneficial for retrieving sensitivity of renal cell cancer to apoptosis Bilim 2008 5 HOXB5 644 chr01q 7770165 7770213 3500008686 48 7770165 7770213 8421504 1 48 0 p 350000868600015019 3-51 Peptides and aptamers for targeting of neuron or nerves Tsien 2010 0 HOXB5 644 chr01q 7770165 7770213 3500008144 48 7770165 7770213 8421504 1 48 0 p 350000814400015005 3-51 Transgenic mouse models of hepatitis c virus (hcv) and identification of hcv therapeutics Frelin 2006 0 MIR615 644 chr01q 7770165 7770213 3500006423 48 7770165 7770213 8421504 1 48 0 p 350000642300015002 0-48 Compositions and methods for detecting and treating HIV infections - Patent # 7662547 - PatentGenius .patentgenius.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500006066 48 7770165 7770213 8421504 1 48 0 p 350000606600015000 18-66 18073344 10.1261/rna.844108 1355-8382 RNA miR-122 targeting with LNA/2′-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA–peptide conjugates Fabani 2008 5 HOXB4 644 chr01q 7770165 7770213 3500003096 48 7770165 7770213 8421504 1 48 0 p 350000309600015019 0-48 TREATMENT OF DISEASE CONDITIONS VIA ADMINISTRATION OF DNA REPAIR ENZYME - UNIVERSITY OF SOUTH ALABAMA www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500001458 48 7770165 7770213 8421504 1 48 0 p 350000145800015001 0-48 Cell-penetrating peptides and bioactive cargoes. Strategies and mechanisms. w.diva-portal.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500389892 45 7770165 7770210 8421504 1 45 0 p 350038989200015010 0-45 METHODS AND COMPOUNDS FOR REDUCING INTRACELLULAR LIPID STORAGE - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500366688 45 7770165 7770210 8421504 1 45 0 p 350036668800015052 0-45 Modified Bacteriophage Vectors and Uses Thereof - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500178016 45 7770165 7770210 8421504 1 45 0 p 350017801600015003 3-48 RGD-independentCellAdhesionviaaTissue Transglutaminase-FibronectinMatrixPromotesFibronectin FibrilDepositionandRequiresSyndecan-4/2and IntegrinCo-signaling S www.jbc.org 0 0 HOXC6 644 chr01q 7770165 7770210 3500158084 45 7770165 7770210 8421504 1 45 0 p 350015808400015009 0-45 Method for Treating and Preventing Ischemia-Reperfusion Injury Using Rna Interfering Agent - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770210 3500107575 45 7770165 7770210 8421504 1 45 0 p 350010757500015002 3-48 The Importance of the Tissue Transglutaminase-Fibronectin Heterocomplex in the RGD-independent Cell Adhesion and Fibronectin Matrix Deposition rints.aston.ac.uk 0 0 HOXC6 644 chr01q 7770165 7770210 3500102585 45 7770165 7770210 8421504 1 45 0 p 350010258500015047 0-45 EMBEDDED CHIMERIC PEPTIDE NUCLEIC ACIDS AND USES THEREOF - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770168 7770213 3500412250 45 7770168 7770213 8421504 1 45 0 p 350041225000015006 0-45 SERPINA1 SIRNAS: COMPOSITIONS OF MATTER AND METHODS OF TREATMENT - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770168 7770213 3500270939 45 7770168 7770213 8421504 1 45 0 p 350027093900015000 0-45 Methods of constructing and screening diverse expression libraries - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770168 7770213 3500210061 45 7770168 7770213 8421504 1 45 0 p 350021006100015002 3-48 Methods of constructing and screening diverse expression libraries - US Patent 7270969 Description ww.patentstorm.us 0 0 MIR615 644 chr01q 7771822 7771847 3500454641 25 7771822 7771847 8421504 1 25 0 c 350045464100000005 0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 644 chr01q 7771822 7771847 3500275698 25 7771822 7771847 8421504 1 25 0 c 350027569800000005 0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 645 chr01q 7895611 7895637 3500306361 23 7895611 7895637 8421504 2 17,6 0,20 g 350030636100000240 8-31 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 591 chr02q 840094 840123 3500248155 25 840094 840123 8421504 3 14,4,7 0,17,22 g 350024815500000071 0-25 <HTML> <HEAD> <TITLE>CSM

587 chr01p 284594 285093 3500114242 80 284594 285093 8421504 2 50,30 0,469 g 350011424200000032 0-80 BMC Genetics BioMed Central biomedcentral.com 0 0 594 chr01p 1306420 1306470 3500304259 50 1306420 1306470 8421504 1 50 0 g 350030425900000155 0-50 BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 597 chr01p 1629435 1629933 3500219244 63 1629435 1629933 8421504 3 36,9,18 0,81,480 p 350021924400015160 81-180 Polypeptides and nucleic acids encoding same Gangolli 2005 0 598 chr01p 1774555 1774578 3500202197 23 1774555 1774578 8421504 1 23 0 g 350020219700000002 0-23 A study of neural-related microRNAs in the developing amphioxus. - ResearchGate .researchgate.net 0 0 MIR3529 598 chr01p 1774555 1774578 3500095127 23 1774555 1774578 8421504 1 23 0 g 350009512700000002 0-23 A study of neural-related microRNAs in the developing amphioxus. .biomedsearch.com 0 0 MIR3529 599 chr01p 1893483 1893510 3500306361 24 1893483 1893510 8421504 2 7,17 0,10 g 350030636100000575 21-45 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 601 chr01p 2173190 2173215 3500228956 25 2173190 2173215 8421504 1 25 0 c,g 350022895600000023,350022895600000023 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 601 chr01p 2173190 2173215 3500193888 25 2173190 2173215 8421504 1 25 0 c,g 350019388800000023,350019388800000023 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 601 chr01p 2173501 2174819 3500388252 54 2173501 2174819 8421504 2 21,33 0,1285 p 350038825200015108,350038825200015168 0-45,0-45 Fusion Protein and Use Thereof - Patent application www.faqs.org 0 0 601 chr01p 2173507 2174816 3500432629 45 2173507 2174816 8421504 2 15,30 0,1279 p 350043262900015046 0-45 CANINE iPS CELLS AND METHOD OF PRODUCING SAME - Patent application www.faqs.org 0 0 601 chr01p 2173513 2174849 3500230063 72 2173513 2174849 8421504 2 9,63 0,1273 p 350023006300015005 0-72 Method for rejuvenating cells LAPASSET 2012 0 601 chr01p 2190011 2190041 3500425093 25 2190011 2190041 8421504 2 7,18 0,12 g 350042509300000172 0-25 PCR METHODS IN FOODS www.ssu.ac.ir 0 0 603 chr01p 2418213 2418236 3500394666 23 2418213 2418236 8421504 1 23 0 g 350039466600000005,350039466600000006 0-20,0-23 Methods Of Nucleic Acid Analysis Hall 2013 0 603 chr01p 2450466 2459853 3500119552 1997 2450466 2459853 8421504 8 1,22,367,239,60,105,163,1040 0,2,281,2695,4832,5406,7466,8347 p,c,g 350011955200000003,350011955200015071,350011955200015065,350011955200015054,350011955200015046,350011955200000000,350011955200015031,350011955200015024,350011955200015038,350011955200015000,350011955200015013,350011955200000006,350011955200000006 8-31,0-252,0-252,0-108,0-252,0-28,0-252,0-252,0-243,0-222,0-147,20-41,20-41 A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit eb.biologists.org 0 0 603 chr01p 2450466 2459841 3500238085 72 2450466 2459841 8421504 4 1,22,28,21 0,2,7488,9354 c,g 350023808500000003,350023808500000000,350023808500000006,350023808500000006 8-31,0-28,20-41,20-41 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 603 chr01p 2450466 2459841 3500185760 72 2450466 2459841 8421504 4 1,22,28,21 0,2,7488,9354 c,g 350018576000000003,350018576000000000,350018576000000000,350018576000000006,350018576000000006 8-31,0-28,0-28,20-41,20-41 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 604 chr01p 2589280 2589307 3500011687 23 2589280 2589307 8421504 2 10,13 0,14 g 350001168700000006 1-33 Identification of Genus Campylobacter and Four Enteropathogenic Campylobacter Species by PCR .tm.mahidol.ac.th 0 0 619 chr01p 4584617 4584640 3500412677 23 4584617 4584640 8421504 1 23 0 g 350041267700000001 1-24 Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos ev.biologists.org 0 0 619 chr01p 4584617 4584640 3500293514 23 4584617 4584640 8421504 1 23 0 g 350029351400000001 1-24 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 619 chr01p 4584617 4584640 3500233803 23 4584617 4584640 8421504 1 23 0 g 350023380300000001 1-24 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 621 chr01p 4838554 4838584 3500214186 26 4838554 4838584 8421504 3 10,11,5 0,11,25 g 350021418600001244 0-26 Highly conserved genes and their use to generate probes and primers for detection of microorganisms - Patent application www.faqs.org 0 0 621 chr01p 4838554 4838584 3500205565 26 4838554 4838584 8421504 3 10,11,5 0,11,25 g 350020556500001224 0-26 HIGHLY CONSERVED GENES AND THEIR USE TO GENERATE PROBES AND PRIMERS FOR DETECTION OF MICROORGANISMS - Patent application www.faqs.org 0 0 623 chr01p 5033306 5041602 3500011483 1890 5033306 5041602 8421504 12 123,164,110,155,171,147,113,154,139,134,327,153 0,860,1919,2658,3207,3886,4538,4927,5387,6575,7213,8143 p,c 350001148300015000,350001148300000001 0-1887,0-1890 KEGG T01056: 778777 www.genome.jp 0 0 624 chr01p 5124665 5124689 3500216241 24 5124665 5124689 8421504 1 24 0 g 350021624100000329,350021624100000407 2-26,19-43 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 625 chr01p 5289273 5289307 3500395481 27 5289273 5289307 8421504 3 6,16,5 0,10,29 g 350039548100000131 17-44 Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius .patentgenius.com 0 0 625 chr01p 5355906 5356440 3500416406 40 5355906 5356440 8421504 2 20,20 0,514 g 350041640600000014,350041640600000015 0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 628 chr01p 5746618 5746645 3500337023 24 5746618 5746645 8421504 2 8,16 0,11 g 350033702300000039 7-31 Methods and compositions for modulating ACE-2 activity osdir.com/patents 0 0 628 chr01p 5746618 5746645 3500334357 24 5746618 5746645 8421504 2 8,16 0,11 g 350033435700000035,350033435700000047 7-31,7-31 Methods and compositions for modulating ACE-2 activity Parry 2002 0 628 chr01p 5746618 5746645 3500242837 24 5746618 5746645 8421504 2 8,16 0,11 g 350024283700000001 7-31 Methods and compositions for modulating ace-2 activity Parry 2002 0 629 chr01p 5770776 5770802 3500091488 23 5770776 5770802 8421504 2 5,18 0,8 g 350009148800000721 23-46 US Patent # 6,376,210. Methods and compositions for assaying analytes - Patents.com www.patents.com 0 0 629 chr01p 5893879 5894956 3500416406 40 5893879 5894956 8421504 2 20,20 0,1057 c,g 350041640600000011,350041640600000011,350041640600000010,350041640600000010 0-20,0-20,0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 630 chr01p 6024453 6024581 3500124262 57 6024453 6024581 8421504 2 30,27 0,101 p 350012426200015000 3-60 10.1042/BJ20041860 Biochemical Journal Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish Takafumi 2005 0 586 chr01q 140859 140904 3500337504 45 140859 140904 8421504 1 45 0 p 350033750400015004 0-45 prdl-a, a gene marker for hydra apical differentiation related to triploblastic paired-like head-speciﬁc genes ev.biologists.org 0 0 ARX 588 chr01q 515030 515081 3500383952 51 515030 515081 8421504 1 51 0 p 350038395200015056 0-51 Yeast cells expressing modified g proteins and methods of use therefor Benegal 2000 0 GNAI2 73 chr01q 519386 524322 3500345036 45 519386 524322 8421504 2 38,7 0,4929 p 350034503600015002 0-45 Human G-protein alpha i2 C352G GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AGC ACC www.cdna.org 0 0 GNAT2 73 chr01q 519386 524322 3500204636 45 519386 524322 8421504 2 38,7 0,4929 p 350020463600015002 0-45 Human G-protein alpha i2 C352I >KpnI GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AG www.cdna.org 0 0 GNAS 73 chr01q 519386 524322 3500199104 45 519386 524322 8421504 2 38,7 0,4929 p 350019910400015002 0-45 Human G-protein alpha i2 Q205L/D273N GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACC GTG AGC GCC GAG GAC AAG GCG GCG GCC GAG CGC TCT AAG ATG ATC GAC AAG AAC CTG CGG GAG GAC GGA GAG AAG GCG GCG CGG GAG GTG AAG TTG CTG CTG TTG GGT GCT GGG GAG TCA GGG AAG AG www.cdna.org 0 0 GNAS 73 chr01q 519389 524340 3500147730 60 519389 524340 8421504 2 35,25 0,4926 p 350014773000015019 51-111 Sequenceanalysis cDNAand DNA www.pnas.org 0 0 597 chr01q 1623977 1630744 3500156021 192 1623977 1630744 8421504 7 23,25,20,45,8,49,22 0,44,109,2756,5988,6387,6745 p,c,g 350015602100000002,350015602100000002,350015602100000006,350015602100000000,350015602100000000,350015602100015001,350015602100015000,350015602100000001,350015602100000003,350015602100000003 0-23,0-23,0-25,0-20,0-20,0-45,0-57,0-21,0-22,0-22 Rosaria De Santis ciCD94-1, an ascidian multipurpose C-type lectin-like receptor expressed in Ciona intestinalishemocytes and larval neural structures www.lambris.com 0 0 599 chr01q 1851818 1864817 3500185870 54 1851818 1864817 8421504 2 27,27 0,12972 g 350018587000000006,350018587000000007 0-27,0-27 Supporting Information www.pnas.org 0 0 600 chr01q 2051142 2051172 3500022998 25 2051142 2051172 8421504 3 6,7,12 0,9,18 g 350002299800000144 7-32 Novel Acetylcholinesterase Gene Responsible for Insecticide Resistance and Applications Thereof - Patent application www.faqs.org 0 0 603 chr01q 2383630 2385266 3500416406 40 2383630 2385266 8421504 2 20,20 0,1616 c,g 350041640600000005,350041640600000004,350041640600000004 0-20,0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 605 chr01q 2660841 2660865 3500304259 24 2660841 2660865 8421504 1 24 0 g 350030425900000179 0-24 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 608 chr01q 3017860 3018517 3500270952 657 3017860 3018517 8421504 1 657 0 p 350027095200015019 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500229082 657 3017860 3018517 8421504 1 657 0 p 350022908200015021 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500179578 657 3017860 3018517 8421504 1 657 0 p 350017957800015019 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 608 chr01q 3017860 3018517 3500072511 657 3017860 3018517 8421504 1 657 0 p 350007251100015018 0-657 バイオインフォマティックス概論授業予定 agri.tohoku.ac.jp 0 0 612 chr01q 3625838 3625866 3500395481 23 3625838 3625866 8421504 2 14,9 0,19 g 350039548100000066 4-27 Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius .patentgenius.com 0 0 616 chr01q 4074692 4074717 3500330399 25 4074692 4074717 8421504 1 25 0 g 350033039900000007 0-25 Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis www.pnas.org 0 0 616 chr01q 4074692 4074717 3500327677 25 4074692 4074717 8421504 1 25 0 g 350032767700000008 0-25 14500781 10.1073/pnas.1634991100 0027-8424 Proceedings of the National Academy of Sciences Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Davidson 2003 10 616 chr01q 4074692 4074717 3500295209 25 4074692 4074717 8421504 1 25 0 g 350029520900000008 0-25 14500781 10.1073/pnas.1634991100 0027-8424 Proceedings of the National Academy of Sciences Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Davidson 2003 10 616 chr01q 4074692 4074717 3500274608 25 4074692 4074717 8421504 1 25 0 g 350027460800000008 0-25 10.1073/pnas.1634991100 Proceedings of the National Academy of Sciences of the United States of America Evolutionary origins of the vertebrate heart: Specification of the cardiac lineage in Ciona intestinalis Brad 2003 0 619 chr01q 4528438 4528812 3500224873 60 4528438 4528812 8421504 2 38,22 0,352 p 350022487300015053,350022487300015010,350022487300015062,350022487300015045 18-78,18-78,0-54,0-54 DissertationABennewizEndfassungelektronische Version 08-2009 diss.fu-berlin.de 0 0 619 chr01q 4528444 4528806 3500374989 48 4528444 4528806 8421504 2 32,16 0,346 p 350037498900015002 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 619 chr01q 4528444 4528806 3500219678 48 4528444 4528806 8421504 2 32,16 0,346 p 350021967800015003 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases Engelhardt 2008 0 619 chr01q 4528444 4528806 3500046035 48 4528444 4528806 8421504 2 32,16 0,346 p 350004603500015002 3-51 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 619 chr01q 4528447 4528806 3500235355 45 4528447 4528806 8421504 2 29,16 0,343 p 350023535500015148 0-45 NON-SMALL CELL LUNG CANCER-RELATED GENE, ANLN, AND ITS INTERACTION WITH RhoA - Patent application www.faqs.org 0 0 621 chr01q 4748662 4749387 3500416406 40 4748662 4749387 8421504 2 20,20 0,705 g 350041640600000022,350041640600000023 0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 626 chr01q 5484653 5484678 3500347923 23 5484653 5484678 8421504 3 14,4,5 0,15,20 g 350034792300000031,350034792300000030 8-33,0-25 EVOLUTION OF YY1, YY2, REX1 AND DNA-BINDING MOTIFS IN VERTEBRATE GENOMES etd.lsu.edu 0 0 628 chr01q 5691703 5694357 3500063800 88 5691703 5694357 8421504 4 22,22,22,22 0,526,2283,2632 c,g 350006380000000008,350006380000000008,350006380000000014,350006380000000014,350006380000000015,350006380000000015,350006380000000009,350006380000000009 0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22 10.1073/pnas.0503640102 Proceedings of the National Academy of Sciences of the United States of America Transposon-mediated insertional mutagenesis revealed the functions of animal cellulose synthase in the ascidian Ciona intestinalis Yasunori 2005 0 632 chr01q 6212509 6216008 3500299524 89 6212509 6216008 8421504 3 40,29,20 0,1864,3479 c,g 350029952400000003,350029952400000003,350029952400000004,350029952400000004,350029952400000007,350029952400000007,350029952400000006,350029952400000006,350029952400000008,350029952400000008 0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20 15201221 10.1242/dev.01201 0950-1991 Development Amphioxus and ascidian Dmbx homeobox genes give clues to the vertebrate origins of midbrain development Takahashi 2004 7 633 chr01q 6314381 6314890 3500316042 41 6314381 6314890 8421504 2 21,20 0,489 g 350031604200000009,350031604200000008 0-21,0-20 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 633 chr01q 6321830 6362756 3500454641 75 6321830 6362756 8421504 3 25,25,25 0,14642,40901 c,g 350045464100000002,350045464100000003,350045464100000003,350045464100000004,350045464100000004 0-25,0-25,0-25,0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 633 chr01q 6321830 6362756 3500275698 75 6321830 6362756 8421504 3 25,25,25 0,14642,40901 c,g 350027569800000002,350027569800000003,350027569800000003,350027569800000004,350027569800000004 0-25,0-25,0-25,0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 633 chr01q 6330750 6332592 3500207888 48 6330750 6332592 8421504 2 46,2 0,1840 p 350020788800015006 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2003 0 633 chr01q 6330750 6332592 3500051201 48 6330750 6332592 8421504 2 46,2 0,1840 p 350005120100015009 0-48 PROMOTION OF PEROXISOMAL CATALASE FUNCTION IN CELLS Terlecky 2003 0 633 chr01q 6330759 6332598 3500360151 45 6330759 6332598 8421504 2 37,8 0,1831 p 350036015100015014 0-45 Toxin compounds with enhanced membrane translocation characteristics Fernandez-salas 2004 0 633 chr01q 6330759 6332598 3500280799 45 6330759 6332598 8421504 2 37,8 0,1831 p 350028079900015013 0-45 Toxin compounds with enhanced membrane translocation characteristics Aoki 2006 0 633 chr01q 6330759 6332598 3500160787 45 6330759 6332598 8421504 2 37,8 0,1831 p 350016078700015012 0-45 TOXIN COMPOUNDS WITH ENHANCED MEMBRANE TRANSLOCATION CHARACTERISTICS Fernandez-salas 2008 0 633 chr01q 6330762 6332601 3500364390 45 6330762 6332601 8421504 2 34,11 0,1828 p 350036439000015012 0-45 Quox-1, a Quail Homeobox Gene Expressed in the Embryonic Central Nervous System, Including the Forebrain www.jstor.org 0 0 634 chr01q 6452290 6481854 3500305932 631 6452290 6481854 8421504 3 389,60,182 0,29309,29382 g 350030593200000103,350030593200000080,350030593200000081,350030593200000104,350030593200000083 0-389,0-21,0-21,0-252,0-21 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 637 chr01q 6939077 6940297 3500349597 48 6939077 6940297 8421504 2 37,11 0,1209 p 350034959700015076 0-48 Methods For Identifying Compounds That Alter Kinase Activity www.docstoc.com 0 0 641 chr01q 7433043 7433076 3500454641 33 7433043 7433076 8421504 1 33 0 c,g 350045464100000007,350045464100000006,350045464100000006 0-25,0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 641 chr01q 7433043 7433076 3500275698 33 7433043 7433076 8421504 1 33 0 c,g 350027569800000007,350027569800000006,350027569800000006 0-25,0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 644 chr01q 7743801 7743825 3500239787 23 7743801 7743825 8421504 2 15,8 0,16 c 350023978700000013 7-30 19534778 10.1186/1471-2202-10-60 1471-2202 BMC Neuroscience Functional and comparative genomics analyses of pmp22 in medaka fish Itou 2009 3 644 chr01q 7743801 7743825 3500073626 23 7743801 7743825 8421504 2 15,8 0,16 c 350007362600000018 7-30 BMC Neuroscience BioMed Central biomedcentral.com 0 0 644 chr01q 7770153 7770213 3500332414 60 7770153 7770213 8421504 1 60 0 p 350033241400015009,350033241400015022,350033241400015017,350033241400015013,350033241400015025,350033241400015003,350033241400015002,350033241400015018,350033241400015019,350033241400015014,350033241400015015,350033241400015016,350033241400015010,350033241400015011,350033241400015012,350033241400015109,350033241400015021,350033241400015020,350033241400015023,350033241400015024,350033241400015007,350033241400015006,350033241400015005,350033241400015004,350033241400015008 0-60,0-54,0-51,0-51,0-51,0-51,0-51,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48 INHIBITORS OF TLR SIGNALING BY TARGETING TIR DOMAIN INTERFACES Toshchakov 2013 0 644 chr01q 7770159 7770213 3500456081 54 7770159 7770213 8421504 1 54 0 p 350045608100015001,350045608100015027 3-48,0-48 Patent Anti-pathogen system and methods of use thereof (Patent US:6221355) Dowdy 2001 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500369525 54 7770159 7770213 8421504 1 54 0 p 350036952500015006,350036952500015004 9-54,99-147 Mcl-1 Quadruplex Nucleic Acids And Uses Thereof .freshpatents.com 0 0 644 chr01q 7770159 7770213 3500361379 54 7770159 7770213 8421504 1 54 0 p 350036137900015001,350036137900015027 3-48,0-48 Anti-pathogen system and methods of use thereof Dowdy 1998 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500189837 54 7770159 7770213 8421504 1 54 0 p 350018983700015019,350018983700015038 3-48,0-48 Anti-pathogen system and methods of use thereof Dowdy 2001 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770159 7770213 3500177121 54 7770159 7770213 8421504 1 54 0 p 350017712100015008,350017712100015006 9-54,99-147 MCL-1 quadruplex nucleic acids and uses thereof Farrell 2006 0 HOXB8,HOXB6,HOXB7,HOXB4,HOXB5,MIR10A 644 chr01q 7770162 7770213 3500326294 51 7770162 7770213 8421504 1 51 0 p 350032629400015005,350032629400015000 0-51,0-48 10064588 10.1093/emboj/18.5.1214 ERROR! NO ISSN The EMBO Journal Translocation of ornithine decarboxylase to the surface membrane during cell activation and transformation Heiskala 1999 0 644 chr01q 7770165 7770216 3500366297 51 7770165 7770216 8421504 1 51 0 p 350036629700015013,350036629700015007,350036629700015005,350036629700015004,350036629700015017 0-51,0-51,0-51,0-51,0-45 Modulation of TRIP-Br function and method of treating proliferative disorders - Patent # 7223733 - PatentGenius .patentgenius.com 0 0 644 chr01q 7770165 7770213 3500466191 48 7770165 7770213 8421504 1 48 0 p 350046619100015002 0-48 PYRROLIDINYL GROUPS FOR ATTACHING CONJUGATES TO OLIGOMERIC COMPOUNDS Swayze 2005 0 HOXB4 644 chr01q 7770165 7770213 3500465520 48 7770165 7770213 8421504 1 48 0 p 350046552000015000,350046552000015001 9-57,9-57 17347452 10.1152/ajpgi.00273.2006 American Journal of Physiology - Gastrointestinal and Liver Physiology Ethanol induced NF-κB activation protects against cell injury in cultured rat gastric mucosal epithelium Mustonen 2007 0 HOXB4 644 chr01q 7770165 7770213 3500463762 48 7770165 7770213 8421504 1 48 0 p 350046376200015015 0-48 Combination therapies with mitochondrial-targeted anti-tumor agents Altieri 2011 0 HOXB4 644 chr01q 7770165 7770213 3500463753 48 7770165 7770213 8421504 1 48 0 p 350046375300015002 0-48 17429072 10.1091/mbc.E06-08-0744 1059-1524 Molecular Biology of the Cell RKIKK Motif in the Intracellular Domain Is Critical for Spatial and Dynamic Organization of ICAM-1: Functional Implication for the Leukocyte Adhesion and Transmigration Oh 2007 5 HOXB4 644 chr01q 7770165 7770213 3500462929 48 7770165 7770213 8421504 1 48 0 p 350046292900015015,350046292900015009 0-48,0-48 GENE SILENCING USING SENSE DNA AND ANTISENSE RNA HYBRID CONSTRUCTS COUPLED TO PEPTIDES FACILITATING THE UPTAKE INTO CELLS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500459634 48 7770165 7770213 8421504 1 48 0 p 350045963400015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7579456) Benedict 2009 0 MIR615 644 chr01q 7770165 7770213 3500459444 48 7770165 7770213 8421504 1 48 0 p 350045944400015021 0-48 Inhibition Of Gasc1 .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500459269 48 7770165 7770213 8421504 1 48 0 p 350045926900015001 0-48 Enhanced efficiency of induced pluripotent stem cell generation Wu 2011 0 HOXB4 644 chr01q 7770165 7770213 3500457784 48 7770165 7770213 8421504 1 48 0 p 350045778400015006 0-48 Modified iRNA agents Manoharan 2004 0 HOXB4 644 chr01q 7770165 7770213 3500457315 48 7770165 7770213 8421504 1 48 0 p 350045731500015001 0-48 23940795 10.1371/journal.pone.0071957 PLoS ONE Phosphorylation of the Actin Binding Protein Drebrin at S647 Is Regulated by Neuronal Activity and PTEN Patricia 2013 0 HOXB4 644 chr01q 7770165 7770213 3500453589 48 7770165 7770213 8421504 1 48 0 p 350045358900015016,350045358900015019 0-48,0-48 Mitochondria-targeted anti-tumor agents Altieri 2009 0 HOXB4 644 chr01q 7770165 7770213 3500452946 48 7770165 7770213 8421504 1 48 0 p 350045294600015027 0-48 Trophinin-binding peptides and uses thereof Fukuda 2008 0 MIR615 644 chr01q 7770165 7770213 3500452430 48 7770165 7770213 8421504 1 48 0 p 350045243000015002 0-48 METHODS OF INDUCING PLURIPOTENCY INVOLVING OCT4 PROTEIN Kirkland 2008 0 HOXB4 644 chr01q 7770165 7770213 3500451805 48 7770165 7770213 8421504 1 48 0 p 350045180500015009 0-48 POLYMERIC CARRIER Stayton 2009 0 HOXB4 644 chr01q 7770165 7770213 3500450490 48 7770165 7770213 8421504 1 48 0 p 350045049000015000 0-48 12788645 10.1016/S1525-0016(03)00130-8 1525-0016 Molecular Therapy A Novel TAT–Mitochondrial Signal Sequence Fusion Protein is Processed, Stays in Mitochondria, and Crosses the Placenta Gaizo 2003 7 HOXB4 644 chr01q 7770165 7770213 3500450280 48 7770165 7770213 8421504 1 48 0 p 350045028000015001 3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:6831065) May 2004 0 HOXB4 644 chr01q 7770165 7770213 3500449540 48 7770165 7770213 8421504 1 48 0 p 350044954000015005 0-48 Therapeutic Compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500447533 48 7770165 7770213 8421504 1 48 0 p 350044753300015019 0-48 特開2010-246542号ＶＨＬ腫瘍サプレッサーと低酸素誘導因子との相互作用、お&#x astamuse.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500446274 48 7770165 7770213 8421504 1 48 0 p 350044627400015000 21-69 18281499 10.1158/0008-5472.CAN-07-6175 0008-5472 Cancer Research Construction of Optimized Bispecific Antibodies for Selective Activation of the Death Receptor CD95 Herrmann 2008 8 HOXB4 644 chr01q 7770165 7770213 3500446139 48 7770165 7770213 8421504 1 48 0 p 350044613900015064,350044613900015085 0-48,0-48 Targeted immunogens Uger 2003 0 HOXB4 644 chr01q 7770165 7770213 3500445605 48 7770165 7770213 8421504 1 48 0 p 350044560500015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500445336 48 7770165 7770213 8421504 1 48 0 p 350044533600015026 0-48 BREAST CANCER-ASSOCIATED GENE, MELK, AND ITS INTERACTIONS WITH BCL-G - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500444542 48 7770165 7770213 8421504 1 48 0 p 350044454200015011 0-48 主题：Regulates | 医源世界 www.39kf.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500443721 48 7770165 7770213 8421504 1 48 0 p 350044372100015004 0-48 Controlling gene expressions in plastids Muhlbauer 2004 0 HOXB5 644 chr01q 7770165 7770213 3500443094 48 7770165 7770213 8421504 1 48 0 p 350044309400015009 0-48 Patent Hemangio-colony forming cells (Patent US:8017393) Lanza 2011 0 HOXC6 644 chr01q 7770165 7770213 3500441271 48 7770165 7770213 8421504 1 48 0 p 350044127100015010 0-48 TRANS-MEMBRANE-ANTIBODY INDUCED INHIBITION OF APOPTOSIS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500440875 48 7770165 7770213 8421504 1 48 0 p 350044087500015001 0-48 Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells ecular-cancer.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500440222 48 7770165 7770213 8421504 1 48 0 p 350044022200015006 0-48 HEMANGIO COLONY FORMING CELLS AND NON-ENGRAFTING HEMANGIO CELLS Lanza 2009 0 HOXB5 644 chr01q 7770165 7770213 3500439758 48 7770165 7770213 8421504 1 48 0 p 350043975800015003,350043975800015004 3-51,3-51 Methods of Treating Hepatitis C Virus Infection - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500437539 48 7770165 7770213 8421504 1 48 0 p 350043753900015023 0-48 COMPOSITIONS FOR NUCLEIC ACID DELIVERY - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500436508 48 7770165 7770213 8421504 1 48 0 p 350043650800015004 0-48 Aptamer therapeutics useful in the treatment of complement-related disorders Benedict 2006 0 HOXB4 644 chr01q 7770165 7770213 3500436372 48 7770165 7770213 8421504 1 48 0 p 350043637200015000,350043637200015002 0-48,0-48 18417477 10.1074/jbc.M710530200 The Journal of Biological Chemistry The Apolipoprotein E-mimetic Peptide COG112 Inhibits the Inflammatory Response to Citrobacter rodentium in Colonic Epithelial Cells by Preventing NF-κB Activation Kshipra June 0 HOXB4 644 chr01q 7770165 7770213 3500433573 48 7770165 7770213 8421504 1 48 0 p 350043357300015001 0-48 Methods of Inducing Tissue Regeneration Blau 2010 0 MIR615 644 chr01q 7770165 7770213 3500430608 48 7770165 7770213 8421504 1 48 0 p 350043060800015001,350043060800015000,350043060800015002 3-51,3-51,3-51 10.1002/ijc.20333 1097-0215 International Journal of Cancer Inhibition of growth and survival of human head and neck squamous cell carcinoma cells by curcumin via modulation of nuclear factor-κB signaling - Aggarwal - 2004 - International Journal of Cancer - Wiley Online Library Aggarwal 2004 0 HOXB4 644 chr01q 7770165 7770213 3500425641 48 7770165 7770213 8421504 1 48 0 p 350042564100015001 0-48 Oligonucleotide Compositions with Enhanced Efficiency Woolf 2010 0 HOXC6 644 chr01q 7770165 7770213 3500423875 48 7770165 7770213 8421504 1 48 0 p 350042387500015004 0-48 Targeting NBS1-ATM Interaction To Sensitize Cancer Cells To Radiotherapy And Chemotherapy Xu 2007 0 HOXB4 644 chr01q 7770165 7770213 3500423289 48 7770165 7770213 8421504 1 48 0 p 350042328900015000 0-48 12902516 0022-1767 The Journal of Immunology Intracellular Domain of Brain Endothelial Intercellular Adhesion Molecule-1 Is Essential for T Lymphocyte-Mediated Signaling and Migration Greenwood 2003 6 HOXC6 644 chr01q 7770165 7770213 3500422960 48 7770165 7770213 8421504 1 48 0 p 350042296000015000 0-48 12902516 0022-1767 The Journal of Immunology Intracellular Domain of Brain Endothelial Intercellular Adhesion Molecule-1 Is Essential for T Lymphocyte-Mediated Signaling and Migration Greenwood 2003 6 HOXB4 644 chr01q 7770165 7770213 3500422615 48 7770165 7770213 8421504 1 48 0 p 350042261500015062,350042261500015021 0-48,0-48 TOPICAL GELS CONTAINING ALPHA CONNEXIN C-TERMINAL (ACT) PEPTIDES - FIRSTSTRING RESEARCH, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500422475 48 7770165 7770213 8421504 1 48 0 p 350042247500015000 0-48 PYRROLIDINYL GROUPS FOR ATTACHING CONJUGATES TO OLIGOMERIC COMPOUNDS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500422214 48 7770165 7770213 8421504 1 48 0 p 350042221400015005,350042221400015014 3-51,3-51 ENTZÜNDUNGSHEMMENDE VERBINDUNGEN UND IHRE VERWENDUNG - Dokument DE60123041T2 www.patent-de.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500421823 48 7770165 7770213 8421504 1 48 0 p 350042182300015006 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING THE CDCA8-AURKB COMPLEX - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500416811 48 7770165 7770213 8421504 1 48 0 p 350041681100015001 0-48 Methods for the Delivery of Oligomeric Compounds - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500415188 48 7770165 7770213 8421504 1 48 0 p 350041518800015006 0-48 Synthetic Lipid Rafts and Methods of Use Khan 2007 0 HOXC6 644 chr01q 7770165 7770213 3500414821 48 7770165 7770213 8421504 1 48 0 p 350041482100015118 0-48 Vivit Polypeptides, Therapeutic Agent Comprising The Same, And Method Of Screening For Anti-cancer Agent .freshpatents.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500414025 48 7770165 7770213 8421504 1 48 0 p 350041402500015040,350041402500015068 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Ghatnekar 2011 0 HOXB5 644 chr01q 7770165 7770213 3500412288 48 7770165 7770213 8421504 1 48 0 p 350041228800015002 0-48 18717816 10.1111/j.1471-4159.2008.05630.x 1471-4159 Journal of Neurochemistry Interaction of caveolin-1, nitric oxide, and nitric oxide synthases in hypoxic human SK-N-MC neuroblastoma cells - Shen - 2008 - Journal of Neurochemistry - Wiley Online Library Shen 2008 0 HOXB4 644 chr01q 7770165 7770213 3500411153 48 7770165 7770213 8421504 1 48 0 p 350041115300015082 0-48 Patent Compositions and methods of use of targeting peptides against placenta and adipose tissues (Patent US:8252764) Pasqualini 2012 0 MIR615 644 chr01q 7770165 7770213 3500410569 48 7770165 7770213 8421504 1 48 0 p 350041056900015003 0-48 Secretion System and Methods for its Use Mougous 2012 0 HOXC6 644 chr01q 7770165 7770213 3500408014 48 7770165 7770213 8421504 1 48 0 p 350040801400015104,350040801400015084,350040801400015126 0-48,0-48,0-48 Composition And Methods For Promoting Wound Healing And Tissue Regeneration .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500405690 48 7770165 7770213 8421504 1 48 0 p 350040569000015008,350040569000015009 0-48,0-48 COMPLEX FOR TRANSFERRING AN ANIONIC SUBSTANCE INTO A CELL - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500403982 48 7770165 7770213 8421504 1 48 0 p 350040398200015016,350040398200015010,350040398200015008,350040398200015012 0-48,0-48,0-48,0-48 Disheveled pdz modulators Costa 2007 0 HOXB4 644 chr01q 7770165 7770213 3500402001 48 7770165 7770213 8421504 1 48 0 p 350040200100015005 0-48 Patent Therapeutic compositions (Patent US:8420799) Manoharan 2013 0 HOXB4 644 chr01q 7770165 7770213 3500401907 48 7770165 7770213 8421504 1 48 0 p 350040190700015003 0-48 10.1091/mbc.E06-08-0744 Molecular Biology of the Cell RKIKK Motif in the Intracellular Domain Is Critical for Spatial and Dynamic Organization of ICAM-1: Functional Implication for the Leukocyte Adhesion and Transmigration Hyun-Mee June 0 HOXB4 644 chr01q 7770165 7770213 3500401579 48 7770165 7770213 8421504 1 48 0 p 350040157900015000 0-48 DSIP | Epitope Tags/Tag Peptides Guide www.ubenimex.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500400715 48 7770165 7770213 8421504 1 48 0 p 350040071500015005 0-48 Patent Therapeutic compositions (Patent US:8110674) Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500400594 48 7770165 7770213 8421504 1 48 0 p 350040059400015001 0-48 17363608 10.1158/0008-5472.CAN-06-4082 0008-5472 Cancer Research Caveolin-1–Deficient Mice Have Increased Tumor Microvascular Permeability, Angiogenesis, and Growth Lin 2007 8 HOXC6 644 chr01q 7770165 7770213 3500399022 48 7770165 7770213 8421504 1 48 0 p 350039902200015000 0-48 Method for preventing or treating memory impairment and pharmaceutical compositions useful therefore Fischer 2013 0 HOXC6 644 chr01q 7770165 7770213 3500398751 48 7770165 7770213 8421504 1 48 0 p 350039875100015000 0-48 Direct Conversion of Cells to Cells of Other Lineages Wernig 2013 0 HOXB4 644 chr01q 7770165 7770213 3500396507 48 7770165 7770213 8421504 1 48 0 p 350039650700015004 0-48 COMPOSITIONS AND METHODS FOR DETECTING AND TREATING HIV INFECTIONS WU 2009 0 MIR615 644 chr01q 7770165 7770213 3500396186 48 7770165 7770213 8421504 1 48 0 p 350039618600015017 0-48 Compositions and Methods for the Delivery of Biologically Active RNAs Polach 2012 0 HOXB4 644 chr01q 7770165 7770213 3500392700 48 7770165 7770213 8421504 1 48 0 p 350039270000015005 0-48 Trans-membrane-antibody induced inhibition of apoptosis Brown 2004 0 MIR615 644 chr01q 7770165 7770213 3500392106 48 7770165 7770213 8421504 1 48 0 p 350039210600015037,350039210600015031 0-48,0-48 Mitochondria-targeted anti-tumor agents Jiang Bing Xian 2010 0 HOXB4 644 chr01q 7770165 7770213 3500390436 48 7770165 7770213 8421504 1 48 0 p 350039043600015002,350039043600015000 3-51,3-51 Anti-inflammatory compounds and uses thereof Ghosh 2002 0 HOXC6 644 chr01q 7770165 7770213 3500388449 48 7770165 7770213 8421504 1 48 0 p 350038844900015005 3-51 Patent Entzündungshemmende verbindungen und ihre verwendung (Patent DE:60123041) GHOSH 2007 0 HOXC6 644 chr01q 7770165 7770213 3500387505 48 7770165 7770213 8421504 1 48 0 p 350038750500015002 0-48 Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof Lee 2009 0 HOXB4 644 chr01q 7770165 7770213 3500383186 48 7770165 7770213 8421504 1 48 0 p 350038318600015007 0-48 Methods of Rejuvenating Cells In Vitro and In Vivo - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500382571 48 7770165 7770213 8421504 1 48 0 p 350038257100015003 0-48 TTK as tumor marker and therapeutic target for lung cancer Nakamura 2012 0 HOXB5 644 chr01q 7770165 7770213 3500381827 48 7770165 7770213 8421504 1 48 0 p 350038182700015000 0-48 Tbc1d7 as tumor marker and therapeutic target for cancer Nakamura 2011 0 MIR615 644 chr01q 7770165 7770213 3500381193 48 7770165 7770213 8421504 1 48 0 p 350038119300015005 0-48 Methods and compositions for delivering polynucleotides Khan 2009 0 HOXC6 644 chr01q 7770165 7770213 3500377058 48 7770165 7770213 8421504 1 48 0 p 350037705800015026 0-48 VIVIT POLYPEPTIDES, THERAPEUTIC AGENT COMPRISING THE SAME, AND METHOD OF SCREENING FOR ANTI-CANCER AGENT - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500374795 48 7770165 7770213 8421504 1 48 0 p 350037479500015037,350037479500015104 0-48,0-48 COMPOSITIONS AND METHODS FOR PROMOTING WOUND HEALING AND TISSUE REGENERATION Gourdie 2007 0 HOXB4 644 chr01q 7770165 7770213 3500373900 48 7770165 7770213 8421504 1 48 0 p 350037390000015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500372129 48 7770165 7770213 8421504 1 48 0 p 350037212900015002,350037212900015001 0-48,60-108 Agent for inhibiting development or progress of proliferative diseases and especially cancer diseases and pharmaceutical composition containing said agent Spaenkuch-Schmitt 2003 0 HOXB4 644 chr01q 7770165 7770213 3500372015 48 7770165 7770213 8421504 1 48 0 p 350037201500015002 0-48 Method for selective oligonucleotide modification Mitsch 2011 0 HOXB4 644 chr01q 7770165 7770213 3500368674 48 7770165 7770213 8421504 1 48 0 p 350036867400015022 0-48 Fusion protein for use as vector Hwu 2002 0 HOXC6 644 chr01q 7770165 7770213 3500368538 48 7770165 7770213 8421504 1 48 0 p 350036853800015020,350036853800015052,350036853800015051 36-84,0-48,39-87 Inhibitors of the interaction between P53 and MDM2 Lane 1997 0 HOXC6 644 chr01q 7770165 7770213 3500368217 48 7770165 7770213 8421504 1 48 0 p 350036821700015001,350036821700015000 3-51,3-51 18978205 10.1182/blood-2008-07-166595 0006-4971 Blood TLR2-dependent eosinophil interactions with mycobacteria: role of α-defensins Driss 2009 10 644 chr01q 7770165 7770213 3500368130 48 7770165 7770213 8421504 1 48 0 p 350036813000015044 0-48 Multimeric peptide conjugates and uses thereof Demeule 2011 0 HOXB4 644 chr01q 7770165 7770213 3500367262 48 7770165 7770213 8421504 1 48 0 p 350036726200015002 0-48 INHIBITION OF ANGIOGENESIS Lagos-quintana 2009 0 HOXB4 644 chr01q 7770165 7770213 3500367224 48 7770165 7770213 8421504 1 48 0 p 350036722400015001 0-48 17363608 10.1158/0008-5472.CAN-06-4082 0008-5472 Cancer Research Caveolin-1–Deficient Mice Have Increased Tumor Microvascular Permeability, Angiogenesis, and Growth Lin 2007 8 HOXB4 644 chr01q 7770165 7770213 3500366636 48 7770165 7770213 8421504 1 48 0 p 350036663600015001 0-48 Carbohydrate conjugates as delivery agents for oligonucleotides - US Patent 8106022 Description ww.patentstorm.us 0 0 HOXB4 644 chr01q 7770165 7770213 3500366555 48 7770165 7770213 8421504 1 48 0 p 350036655500015000 0-48 Способ введения молекулы пнк, конъюг&# www.freepatent.ru 0 0 HOXB4 644 chr01q 7770165 7770213 3500361876 48 7770165 7770213 8421504 1 48 0 p 350036187600015105 0-48 Transducible Polypeptides For Modifying Metabolism .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500361143 48 7770165 7770213 8421504 1 48 0 p 350036114300015228 0-48 Peptidic modulators of the androgen receptor Joyal 2002 0 HOXB4 644 chr01q 7770165 7770213 3500360151 48 7770165 7770213 8421504 1 48 0 p 350036015100015007 0-48 Toxin compounds with enhanced membrane translocation characteristics Fernandez-salas 2004 0 HOXC6 644 chr01q 7770165 7770213 3500358319 48 7770165 7770213 8421504 1 48 0 p 350035831900015001,350035831900015000 9-57,9-57 Ethanol induced NF- B activation protects against cell injury in cultured rat gastric mucosal epithelium--《美国胃肠与肝生理学杂志》--医学期刊频&#x journal.9med.net 0 0 HOXB4 644 chr01q 7770165 7770213 3500352610 48 7770165 7770213 8421504 1 48 0 p 350035261000015005 0-48 Caveolin-1-deficient mice have increased tumor microvascular permeability, angiogenesis, and growth. - ResearchGate .researchgate.net 0 0 HOXC6 644 chr01q 7770165 7770213 3500352503 48 7770165 7770213 8421504 1 48 0 p 350035250300015001,350035250300015007 0-48,0-48 E2F AS A TARGET OF HORMONE REFRACTORY PROSTATE CANCER Bertino 2011 0 HOXC6 644 chr01q 7770165 7770213 3500351230 48 7770165 7770213 8421504 1 48 0 p 350035123000015041 0-48 Peptide Antiestrogen Compositions And Methods For Treating Breast Cancer - Patent 6306832 www.docstoc.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500350992 48 7770165 7770213 8421504 1 48 0 p 350035099200015000 0-48 特開2010-501161号ＲＥＧ４またはＫＩＡＡ０１０１を過剰発現している癌の治&#x astamuse.com 0 0 MIR615 644 chr01q 7770165 7770213 3500350744 48 7770165 7770213 8421504 1 48 0 p 350035074400015004 0-48 INHIBITION OF INFLAMMATION USING ANTAGONISTS OF MUC1 Kufe 2010 0 MIR615 644 chr01q 7770165 7770213 3500348094 48 7770165 7770213 8421504 1 48 0 p 350034809400015005 0-48 Pharmaceutical Composition for Treating Autoimmune, Allergic and Inflammatory Diseases and Delivery Method Thereof - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500346772 48 7770165 7770213 8421504 1 48 0 p 350034677200015018 3-51 PEPTIDES AND APTAMERS FOR TARGETING OF NEURON OR NERVES Tsien 2010 0 HOXC6 644 chr01q 7770165 7770213 3500346493 48 7770165 7770213 8421504 1 48 0 p 350034649300015012 0-48 TREATMENT OF CANCER VIA TARGETING OF IL-13 RECEPTOR-ALPHA2 - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500346275 48 7770165 7770213 8421504 1 48 0 p 350034627500015000 0-48 12788645 10.1016/S1525-0016(03)00130-8 1525-0016 Molecular Therapy A Novel TAT–Mitochondrial Signal Sequence Fusion Protein is Processed, Stays in Mitochondria, and Crosses the Placenta Gaizo 2003 7 HOXB5 644 chr01q 7770165 7770213 3500346273 48 7770165 7770213 8421504 1 48 0 p 350034627300015025 0-48 BLOCKADE OF TL1A-DR3 INTERACTIONS TO AMELIORATE T CELL MEDIATED DISEASE PATHOLOGY Siegel 2008 0 HOXB5 644 chr01q 7770165 7770213 3500345122 48 7770165 7770213 8421504 1 48 0 p 350034512200015013 0-48 DPY-30 Binding Peptides Yang 2012 0 HOXB4 644 chr01q 7770165 7770213 3500341491 48 7770165 7770213 8421504 1 48 0 p 350034149100015003 0-48 Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring Bao 2003 0 HOXB5 644 chr01q 7770165 7770213 3500339578 48 7770165 7770213 8421504 1 48 0 p 350033957800015003 0-48 COMPOSITIONS AND METHODS FOR TREATING CARDIOVASCULAR DISEASE - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500337670 48 7770165 7770213 8421504 1 48 0 p 350033767000015003 0-48 METHOD FOR TREATING OR PREVENTING BLADDER CANCER USING THE DEPDC1 POLYPEPTIDE - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500336324 48 7770165 7770213 8421504 1 48 0 p 350033632400015000 0-48 Conjugate of a transport protein and a protein for modulation of notch signalling Champion 2002 0 MIR615 644 chr01q 7770165 7770213 3500335879 48 7770165 7770213 8421504 1 48 0 p 350033587900015006 0-48 METHOD FOR INTRODUCING A PNA MOLECULE CONJUGATED TO A POSITIVELY CHARGED PEPTIDE INTO THE CYTOSOL AND/OR THE NUCLEUS BY PHOTOCHEMICAL INTERNALISATION (PCI) - THE NORWEGIAN RADIUM HOSPITAL RESEARCH FOUNDATION www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500333591 48 7770165 7770213 8421504 1 48 0 p 350033359100015011 0-48 NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500333330 48 7770165 7770213 8421504 1 48 0 p 350033333000015009 0-48 METHODS AND COMPOSITIONS FOR DELIVERY OF ACTIVE AGENTS Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500332070 48 7770165 7770213 8421504 1 48 0 p 350033207000015070,350033207000015088,350033207000015107 0-48,0-48,0-48 Composition And Methods For Promoting Wound Healing And Tissue Regeneration www.docstoc.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500328481 48 7770165 7770213 8421504 1 48 0 p 350032848100015009 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2004 0 HOXB4 644 chr01q 7770165 7770213 3500328352 48 7770165 7770213 8421504 1 48 0 p 350032835200015005 0-48 Trans-membrane-antibody induced inhibition of apoptosis Brown 2005 0 HOXB4 644 chr01q 7770165 7770213 3500327955 48 7770165 7770213 8421504 1 48 0 p 350032795500015104,350032795500015105 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung (Patent DE:60106423) Findeis 2005 0 HOXB4 644 chr01q 7770165 7770213 3500327712 48 7770165 7770213 8421504 1 48 0 p 350032771200015008,350032771200015000 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung Anti-inflammatory compounds, and their use (Patent DE:60123041) GHOSH 2007 0 HOXB4 644 chr01q 7770165 7770213 3500325895 48 7770165 7770213 8421504 1 48 0 p 350032589500015000 0-48 ACTIVATION OF INNATE IMMUNITY FOR NUCLEAR REPROGRAMMING OF SOMATIC CELLS Cooke 2013 0 HOXB4 644 chr01q 7770165 7770213 3500324849 48 7770165 7770213 8421504 1 48 0 p 350032484900015011 0-48 Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells Chen 2005 0 MIR615 644 chr01q 7770165 7770213 3500324644 48 7770165 7770213 8421504 1 48 0 p 350032464400015000 3-51 19282837 10.1038/jid.2009.49 0022-202X Journal of Investigative Dermatology Bcl-3 Acts as an Innate Immune Modulator by Controlling Antimicrobial Responses in Keratinocytes Buchau 2009 6 MIR615 644 chr01q 7770165 7770213 3500321661 48 7770165 7770213 8421504 1 48 0 p 350032166100015005 0-48 Therapeutic Compositions Manoharan 2010 0 HOXB5 644 chr01q 7770165 7770213 3500318300 48 7770165 7770213 8421504 1 48 0 p 350031830000015053 0-48 COMPOSITIONS AND METHODS FOR MODULATING NOD-LIKE RECEPTOR ACTIVITY AND USES THEREOF - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500316598 48 7770165 7770213 8421504 1 48 0 p 350031659800015003,350031659800015005 39-87,0-48 用于递送治疗剂的新型脂质和组合物 For the delivery of therapeutic agents and compositions of novel lipid Kai Lan Tuo Ta Ti Er *G*La Ji Fu 2011 0 MIR615 644 chr01q 7770165 7770213 3500316176 48 7770165 7770213 8421504 1 48 0 p 350031617600015035 0-48 Screening and therapeutic method for nsclc targeting the cdca8-aurkb complex Daigo 2008 0 HOXB5 644 chr01q 7770165 7770213 3500315135 48 7770165 7770213 8421504 1 48 0 p 350031513500015035 0-48 Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders Bedi 2009 0 HOXB5 644 chr01q 7770165 7770213 3500315070 48 7770165 7770213 8421504 1 48 0 p 350031507000015012 0-48 2-F MODIFIED RNA INTERFERENCE AGENTS - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500314426 48 7770165 7770213 8421504 1 48 0 p 350031442600015000 0-48 TBC1D7 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR CANCER - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500313912 48 7770165 7770213 8421504 1 48 0 p 350031391200015005 0-48 Synthetic lipid rafts and methods of use Khan 2007 0 HOXC6 644 chr01q 7770165 7770213 3500306786 48 7770165 7770213 8421504 1 48 0 p 350030678600015017 0-48 Cell-killing molecules and methods of use thereof Larrick 2004 0 HOXB5 644 chr01q 7770165 7770213 3500306510 48 7770165 7770213 8421504 1 48 0 p 350030651000015002 0-48 Application # 2012/0136042. CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - Patents.com patents.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500301507 48 7770165 7770213 8421504 1 48 0 p 350030150700015009 0-48 Hemangio-colony forming cells Lanza 2008 0 HOXC6 644 chr01q 7770165 7770213 3500295035 48 7770165 7770213 8421504 1 48 0 p 350029503500015000,350029503500015002 0-48,0-48 TheApolipoproteinE-MimeticPeptideCOG112Inhibits BSignaling,ProinflammatoryCytokineExpression,and DiseaseActivityinMurineModelsofColitis S www.jbc.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500294875 48 7770165 7770213 8421504 1 48 0 p 350029487500015007 0-48 PHOSPHOROTHIOATE OLIGONUCLEOTIDES AND NON-NUCLEOSIDIC PHOSPHOROTHIOATES AS DELIVERY AGENTS FOR iRNA AGENTS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500294824 48 7770165 7770213 8421504 1 48 0 p 350029482400015011 0-48 Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500293679 48 7770165 7770213 8421504 1 48 0 p 350029367900015009 0-48 LIPID FORMULATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500293397 48 7770165 7770213 8421504 1 48 0 p 350029339700015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500293383 48 7770165 7770213 8421504 1 48 0 p 350029338300015000 0-48 22676333 10.1186/1756-0500-5-268 BMC Research Notes Ribozyme-mediated gene knock down strategy to dissect the consequences of PDGF stimulation in vascular smooth muscle cells Caterina 2012 0 HOXB4 644 chr01q 7770165 7770213 3500293304 48 7770165 7770213 8421504 1 48 0 p 350029330400015007 0-48 MODIFIED MOLECULAR BEACONS - GEORGIA TECH RESEARCH CORPORATION www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500292474 48 7770165 7770213 8421504 1 48 0 p 350029247400015009 0-48 NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500291281 48 7770165 7770213 8421504 1 48 0 p 350029128100015005 0-48 Pharmaceutical Composition for Treating Autoimmune, Allergic and Inflammatory Diseases and Delivery Method Thereof Lee 2010 0 HOXB4 644 chr01q 7770165 7770213 3500285212 48 7770165 7770213 8421504 1 48 0 p 350028521200015009 0-48 11102469 0270-6474 The Journal of Neuroscience GABAC Receptor Sensitivity Is Modulated by Interaction with MAP1B Billups 2000 7 HOXB4 644 chr01q 7770165 7770213 3500285062 48 7770165 7770213 8421504 1 48 0 p 350028506200015004 0-48 Method for introducing a pna molecule conjugated to a positively charged peptide into the cytosol and/or the nucleus by photochemical internalisation (pci) Boee 2006 0 HOXB4 644 chr01q 7770165 7770213 3500284191 48 7770165 7770213 8421504 1 48 0 p 350028419100015001 0-48 10.1182/blood-2006-07-034009 Blood Caveolin-1 regulates expression of junction-associated proteins in brain microvascular endothelial cells Li 2007 0 HOXB4 644 chr01q 7770165 7770213 3500282320 48 7770165 7770213 8421504 1 48 0 p 350028232000015001 0-48 INDUCED PLURIPOTENT STEM CELLS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500281646 48 7770165 7770213 8421504 1 48 0 p 350028164600015013 0-48 Patent 靶向线粒体的抗肿瘤剂 (Patent CN:101854955) Jiang Bing Xian 2012 0 HOXB4 644 chr01q 7770165 7770213 3500280799 48 7770165 7770213 8421504 1 48 0 p 350028079900015006 0-48 Toxin compounds with enhanced membrane translocation characteristics Aoki 2006 0 HOXB4 644 chr01q 7770165 7770213 3500280211 48 7770165 7770213 8421504 1 48 0 p 350028021100015024 0-48 Compositions and methods for modulating nod-like receptor activity and uses thereof Faustin 2011 0 MIR615 644 chr01q 7770165 7770213 3500279235 48 7770165 7770213 8421504 1 48 0 p 350027923500015022 0-48 SureChem - Document - WO/PCT - Patent No. 2008020596 - "TREATING OR PREVENTING CANCERS OVER-EXPRESSING REG4 OR KIAA0101" - Description www.surechem.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500278948 48 7770165 7770213 8421504 1 48 0 p 350027894800015025 0-48 Patent Mitochondria-targeted anti-tumor agents (Patent CN:101854955) Jiang Bing Xian 2012 0 MIR615 644 chr01q 7770165 7770213 3500276741 48 7770165 7770213 8421504 1 48 0 p 350027674100015008 0-48 CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500275686 48 7770165 7770213 8421504 1 48 0 p 350027568600015000 0-48 22676333 10.1186/1756-0500-5-268 1756-0500 BMC Research Notes Ribozyme-mediated gene knock down strategy to dissect the consequences of PDGF stimulation in vascular smooth muscle cells Lande 2012 0 HOXC6 644 chr01q 7770165 7770213 3500275354 48 7770165 7770213 8421504 1 48 0 p 350027535400015009 0-48 LIPID FORMULATION - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500273506 48 7770165 7770213 8421504 1 48 0 p 350027350600015000 36-84 <HTML> <HEAD><TITLE>ae1a$?aaC/aaa|a$?a<<a1aa-a?a1/4aa3aa(r)a1/2ePS1/2ae1ae3 - c1ei1/4 www.j-tokkyo.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500268198 48 7770165 7770213 8421504 1 48 0 p 350026819800015058 0-48 INHIBITORS OF PROTEIN KINASE C ISOFORMS AND USES THEREOF - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500266522 48 7770165 7770213 8421504 1 48 0 p 350026652200015043 0-48 Peptide antiestrogen compositions and methods for treating breast cancer Pietras 2000 0 MIR615 644 chr01q 7770165 7770213 3500266404 48 7770165 7770213 8421504 1 48 0 p 350026640400015011,350026640400015012,350026640400015082,350026640400015081,350026640400015084,350026640400015003 0-48,0-48,18-63,15-60,27-72,0-45 Peptide oligonucleotide conjugates Hanson 2012 0 MIR615 644 chr01q 7770165 7770213 3500266262 48 7770165 7770213 8421504 1 48 0 p 350026626200015009 0-48 Methods and compositions for identifying RNA-binding proteins - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500264566 48 7770165 7770213 8421504 1 48 0 p 350026456600015017 0-48 Cell-killing molecules and methods of use thereof Larrick 2005 0 HOXB4 644 chr01q 7770165 7770213 3500264500 48 7770165 7770213 8421504 1 48 0 p 350026450000015173,350026450000015174,350026450000015175 3-51,3-51,3-48 Anti-inflammatory Compounds And Uses Thereof .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500263859 48 7770165 7770213 8421504 1 48 0 p 350026385900015001 0-48 COMPOSITIONS AND METHODS FOR MODIFYING THE GLYCOSYLATION PATTERN OF A POLYPEPTIDE Rossomando 2011 0 HOXB4 644 chr01q 7770165 7770213 3500259901 48 7770165 7770213 8421504 1 48 0 p 350025990100015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500259558 48 7770165 7770213 8421504 1 48 0 p 350025955800015000 0-48 15536091 10.1074/jbc.M411380200 0021-9258 Journal of Biological Chemistry Fyn Phosphorylates Human MAP-2c on Tyrosine 67 Zamora-Leon 2005 5 HOXB4 644 chr01q 7770165 7770213 3500259447 48 7770165 7770213 8421504 1 48 0 p 350025944700015003 0-48 Vivit polypeptides, therapeutic agent comprising the same, and method of screening for anti-cancer agent Inaki 2007 0 HOXC6 644 chr01q 7770165 7770213 3500257959 48 7770165 7770213 8421504 1 48 0 p 350025795900015085,350025795900015105,350025795900015065 0-48,0-48,0-48 Composition and Methods for Promoting Wound Healing and tissue Regeneration Ghatnekar 2008 0 HOXB5 644 chr01q 7770165 7770213 3500257921 48 7770165 7770213 8421504 1 48 0 p 350025792100015002 3-51 14560006 10.1128/MCB.23.21.7600-7610.2003 0270-7306 Molecular and Cellular Biology Fibroblast Growth Factor 2-Mediated Translational Control of IAPs Blocks Mitochondrial Release of Smac/DIABLO and Apoptosis in Small Cell Lung Cancer Cells Pardo 2003 6 HOXB5 644 chr01q 7770165 7770213 3500257622 48 7770165 7770213 8421504 1 48 0 p 350025762200015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiolog Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXB5 644 chr01q 7770165 7770213 3500257107 48 7770165 7770213 8421504 1 48 0 p 350025710700015012,350025710700015011,350025710700015003,350025710700015081,350025710700015082,350025710700015084 0-48,0-48,0-45,15-60,18-63,27-72 Peptide oligonucleotide conjugates Hanson 2012 0 MIR615 644 chr01q 7770165 7770213 3500256607 48 7770165 7770213 8421504 1 48 0 p 350025660700015002 0-48 Patent Carbohydrate conjugates as delivery agents for oligonucleotides (Patent US:8106022) Manoharan 2012 0 HOXB4 644 chr01q 7770165 7770213 3500255463 48 7770165 7770213 8421504 1 48 0 p 350025546300015002,350025546300015005 0-48,0-48 10454568 0270-7306 Molecular and Cellular Biology Grb10, a Positive, Stimulatory Signaling Adapter in Platelet-Derived Growth Factor BB-, Insulin-Like Growth Factor I-, and Insulin-Mediated Mitogenesis Wang 1999 6 644 chr01q 7770165 7770213 3500254638 48 7770165 7770213 8421504 1 48 0 p 350025463800015002 0-48 Secretion System and Methods for its Use - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500254081 48 7770165 7770213 8421504 1 48 0 p 350025408100015034,350025408100015101 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Gourdie 2009 0 MIR615 644 chr01q 7770165 7770213 3500248458 48 7770165 7770213 8421504 1 48 0 p 350024845800015034,350024845800015101 0-48,0-48 Patent Compositions and methods for promoting wound healing and tissue regeneration (Patent US:7888319) Ghatnekar 2011 0 MIR615 644 chr01q 7770165 7770213 3500246174 48 7770165 7770213 8421504 1 48 0 p 350024617400015075 0-48 Chimeric peptides including a penetrating peptide and a binding domain of pp2a catalytic subunit to caspase-9 Decaudin 2012 0 MIR615 644 chr01q 7770165 7770213 3500245057 48 7770165 7770213 8421504 1 48 0 p 350024505700015001 0-48 Controlling gene expression in plastids Muehlbauer 2005 0 MIR615 644 chr01q 7770165 7770213 3500243302 48 7770165 7770213 8421504 1 48 0 p 350024330200015006 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING CDCA1-KNTC2 COMPLEX - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500242047 48 7770165 7770213 8421504 1 48 0 p 350024204700015001 0-48 Proteínas recombinantes ligadas a TAT e sua aplicação terapêutica na reversão de dano isquêmico de ilhotas pancreáticas: impacto em transplante bdtd.bce.unb.br 0 0 HOXB4 644 chr01q 7770165 7770213 3500239691 48 7770165 7770213 8421504 1 48 0 p 350023969100015001 3-51 Patent Inhibition of NF-κB activation by blockade of IKKβ-NEMO interactions at the NEMO binding domain (Patent US:6864355) Ghosh 2005 0 HOXB4 644 chr01q 7770165 7770213 3500239523 48 7770165 7770213 8421504 1 48 0 p 350023952300015000 0-48 19006449 10.1089/oli.2008.0152 Oligonucleotides Immunological Response to Peptide Nucleic Acid and its Peptide Conjugate Targeted to Transactivation Response (TAR) Region of HIV-1 RNA Genome Alok 2008 0 HOXB4 644 chr01q 7770165 7770213 3500237127 48 7770165 7770213 8421504 1 48 0 p 350023712700015009 0-48 Hemangio-colony forming cells Lanza 2007 0 MIR615 644 chr01q 7770165 7770213 3500236863 48 7770165 7770213 8421504 1 48 0 p 350023686300015001 3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:8217138) Ghosh 2012 0 MIR615 644 chr01q 7770165 7770213 3500233517 48 7770165 7770213 8421504 1 48 0 p 350023351700015002 0-48 Bacteriophage preparation for the treatment of intracellular bacterial infection Pasechnik 2003 0 HOXB4 644 chr01q 7770165 7770213 3500231908 48 7770165 7770213 8421504 1 48 0 p 350023190800015019,350023190800015051 30-78,0-48 Patent Inhibitions of the interaction between p53 and mdm2 (Patent EP:0958305) BOTTGER 2008 0 HOXB4 644 chr01q 7770165 7770213 3500231526 48 7770165 7770213 8421504 1 48 0 p 350023152600015002 0-48 INHIBITION OF INFLAMMATION USING ANTAGONISTS OF MUC1 - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500230941 48 7770165 7770213 8421504 1 48 0 p 350023094100015000 0-48 Treating or preventing cancers over-expressing reg4 or kiaa0101 Nakagawa 2008 0 HOXC6 644 chr01q 7770165 7770213 3500229598 48 7770165 7770213 8421504 1 48 0 p 350022959800015005,350022959800015020 0-48,0-45 ALGAL TRANSFORMATION SYSTEMS, COMPOSITIONS AND METHODS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500228854 48 7770165 7770213 8421504 1 48 0 p 350022885400015014 0-48 SITE-SPECIFIC DELIVERY OF NUCLEIC ACIDS BY COMBINING TARGETING LIGANDS WITH ENDOSOMOLYTIC COMPONENTS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500227230 48 7770165 7770213 8421504 1 48 0 p 350022723000015003 0-48 COMPOSITIONS AND METHODS FOR DIAGNOSING AUTISM Millonig 2013 0 HOXB4 644 chr01q 7770165 7770213 3500226091 48 7770165 7770213 8421504 1 48 0 p 350022609100015038,350022609100015067 0-48,0-48 Compositions and methods for promoting wound healing and tissue regeneration Gourdie 2011 0 HOXB4 644 chr01q 7770165 7770213 3500225366 48 7770165 7770213 8421504 1 48 0 p 350022536600015010 0-48 Patent Methods and compositions for delivering polynucleotides (Patent US:8039587) Khan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500218975 48 7770165 7770213 8421504 1 48 0 p 350021897500015003 0-48 Patent Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring (Patent US:7459145) Bao 2008 0 HOXC6 644 chr01q 7770165 7770213 3500218826 48 7770165 7770213 8421504 1 48 0 p 350021882600015073 0-48 Targeted immunogens Barber 2003 0 HOXC6 644 chr01q 7770165 7770213 3500217946 48 7770165 7770213 8421504 1 48 0 p 350021794600015005 0-48 TRANS-MEMBRANE-ANTIBODY INDUCED INHIBITION OF APOPTOSIS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500216592 48 7770165 7770213 8421504 1 48 0 p 350021659200015000 0-48 TTK AS TUMOR MARKER AND THERAPEUTIC TARGET FOR LUNG CANCER - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 MIR615 644 chr01q 7770165 7770213 3500216564 48 7770165 7770213 8421504 1 48 0 p 350021656400015000 0-48 21402890 10.4049/jimmunol.1002424 0022-1767 The Journal of Immunology Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface Toshchakov 2011 6 MIR615 644 chr01q 7770165 7770213 3500215589 48 7770165 7770213 8421504 1 48 0 p 350021558900015000 0-48 19961612 10.1186/1742-4690-6-112 1742-4690 Retrovirology Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal Levin 2009 6 HOXB5 644 chr01q 7770165 7770213 3500214662 48 7770165 7770213 8421504 1 48 0 p 350021466200015001 0-48 Controlling gene expression in plastids Muehlbauer 2005 0 HOXC6 644 chr01q 7770165 7770213 3500213268 48 7770165 7770213 8421504 1 48 0 p 350021326800015002 0-48 PEPTIDES TARGETED TO PROTEIN KINASE C ISOFORMS AND USES THEREOF - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500213265 48 7770165 7770213 8421504 1 48 0 p 350021326500015009,350021326500015016 0-48,18-66 MicroRNA Antisense PNAs, Compositions Comprising the Same, and Methods for Using and Evaluating the Same Oh 2010 0 MIR615 644 chr01q 7770165 7770213 3500211965 48 7770165 7770213 8421504 1 48 0 p 350021196500015010 0-48 Immunogenic Polypeptides and Monoclonal Antibodies - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500211732 48 7770165 7770213 8421504 1 48 0 p 350021173200015005 0-48 主题：Nuclear | 医源世界 www.39kf.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500209792 48 7770165 7770213 8421504 1 48 0 p 350020979200015030 0-48 Compositions and methods of use of targeting peptides against placenta and adipose tissues osdir.com/patents 0 0 HOXC6 644 chr01q 7770165 7770213 3500208092 48 7770165 7770213 8421504 1 48 0 p 350020809200015019,350020809200015020 3-51,0-48 Molecular vaccine linking intercellular spreading protein to an antigen Wu 2003 0 HOXB4 644 chr01q 7770165 7770213 3500208064 48 7770165 7770213 8421504 1 48 0 p 350020806400015012 0-48 COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY Cui 2007 0 HOXB4 644 chr01q 7770165 7770213 3500207888 48 7770165 7770213 8421504 1 48 0 p 350020788800015000 0-48 Promotion of peroxisomal catalase function in cells Terlecky 2003 0 HOXB4 644 chr01q 7770165 7770213 3500206127 48 7770165 7770213 8421504 1 48 0 p 350020612700015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiology Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXC6 644 chr01q 7770165 7770213 3500202479 48 7770165 7770213 8421504 1 48 0 p 350020247900015001 0-48 Double-stranded oligonucleotides Wiederholt 2003 0 MIR615 644 chr01q 7770165 7770213 3500201468 48 7770165 7770213 8421504 1 48 0 p 350020146800015016 0-48 Immunogenic Polypeptides and Monoclonal Antibodies Ochs 2012 0 HOXB5 644 chr01q 7770165 7770213 3500200898 48 7770165 7770213 8421504 1 48 0 p 350020089800015009 0-48 Lipid formulation Chen 2010 0 HOXC6 644 chr01q 7770165 7770213 3500200892 48 7770165 7770213 8421504 1 48 0 p 350020089200015004 0-48 Fusion proteins for the treatment of CNS Gruskin 2004 0 HOXC6 644 chr01q 7770165 7770213 3500200713 48 7770165 7770213 8421504 1 48 0 p 350020071300015012,350020071300015015,350020071300015009,350020071300015010 0-48,0-48,0-48,0-48 Disheveled pdz modulators Costa 2010 0 644 chr01q 7770165 7770213 3500199113 48 7770165 7770213 8421504 1 48 0 p 350019911300015000,350019911300015001 9-57,9-57 17347452 10.1152/ajpgi.00273.2006 American Journal of Physiology - Gastrointestinal and Liver Physiology Ethanol induced NF-κB activation protects against cell injury in cultured rat gastric mucosal epithelium Mustonen 2007 0 HOXC6 644 chr01q 7770165 7770213 3500197411 48 7770165 7770213 8421504 1 48 0 p 350019741100015125 0-48 HUMAN AND MOUSE TARGETING PEPTIDES IDENTIFIED BY PHAGE DISPLAY Arap 2011 0 HOXB4 644 chr01q 7770165 7770213 3500196917 48 7770165 7770213 8421504 1 48 0 p 350019691700015001,350019691700015000 60-108,60-108 Cyclin D1 Regulates Cellular Migration through the Inhibition of Thrombospondin 1 and ROCK Signaling mcb.asm.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500196713 48 7770165 7770213 8421504 1 48 0 p 350019671300015002 0-48 10.5772/55518 978-953-51-1014-9 Gene Therapy - Tools and Potential Applications Ian 2013 0 HOXB4 644 chr01q 7770165 7770213 3500196159 48 7770165 7770213 8421504 1 48 0 p 350019615900015018,350019615900015022 0-48,0-45 Interaction Between the VHL Tumour Suppressor and Hypoxia Inducible Factor, and Assay Methods Relating Thereto - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500196068 48 7770165 7770213 8421504 1 48 0 p 350019606800015004 0-48 FACTOR Maden 2009 0 HOXB4 644 chr01q 7770165 7770213 3500193251 48 7770165 7770213 8421504 1 48 0 p 350019325100015001 0-48 TTK AS TUMOR MARKER AND THERAPEUTIC TARGET FOR LUNG CANCER Nakamura 2007 0 MIR615 644 chr01q 7770165 7770213 3500192444 48 7770165 7770213 8421504 1 48 0 p 350019244400015000 0-48 22510693 10.1038/ncomms1773 2041-1733 Nature Communications Combinatorial targeting and discovery of ligand-receptors in organelles of mammalian cells Rangel 2012 0 MIR615 644 chr01q 7770165 7770213 3500191638 48 7770165 7770213 8421504 1 48 0 p 350019163800015086 0-48 Compositions and methods of use of targeting peptides against placenta and adipose tissues Pasqualini 2002 0 MIR615 644 chr01q 7770165 7770213 3500191320 48 7770165 7770213 8421504 1 48 0 p 350019132000015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500190261 48 7770165 7770213 8421504 1 48 0 p 350019026100015001 0-48 22913813 10.1186/1476-4598-11-59 1476-4598 Molecular Cancer Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells Horibe 2012 4 HOXC6 644 chr01q 7770165 7770213 3500188425 48 7770165 7770213 8421504 1 48 0 p 350018842500015003 0-48 CYCLIC DI-AMP INDUCTION OF TYPE I INTERFERON Portnoy 2011 0 HOXB4 644 chr01q 7770165 7770213 3500183031 48 7770165 7770213 8421504 1 48 0 p 350018303100015000 0-48 Screening method of anti-lung or esophageal cancer compounds Daigo 2011 0 HOXC6 644 chr01q 7770165 7770213 3500180627 48 7770165 7770213 8421504 1 48 0 p 350018062700015010 0-48 ＶＨＬ腫瘍サプレッサーと低酸素誘導因子との相互作用、およびそれに astamuse.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500180482 48 7770165 7770213 8421504 1 48 0 p 350018048200015004 0-48 Methods and compositions for delivering polynucleotides Khan 2005 0 HOXB4 644 chr01q 7770165 7770213 3500179659 48 7770165 7770213 8421504 1 48 0 p 350017965900015002 0-48 Factor Maden 2007 0 HOXC6 644 chr01q 7770165 7770213 3500177658 48 7770165 7770213 8421504 1 48 0 p 350017765800015000,350017765800015001 3-51,3-51 20139273 10.4049/jimmunol.0903133 0022-1767 The Journal of Immunology IL-17 Activates the Canonical NF-κB Signaling Pathway in Autoimmune B Cells of BXD2 Mice To Upregulate the Expression of Regulators of G-Protein Signaling 16 Xie 2010 6 HOXB4 644 chr01q 7770165 7770213 3500175950 48 7770165 7770213 8421504 1 48 0 p 350017595000015013 0-48 Compositions And Methods For The Delivery Of Biologically Active RNAs - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500175345 48 7770165 7770213 8421504 1 48 0 p 350017534500015014 0-48 Genetically Intact Induced Pluripotent Cells Or Transdifferentiated Cells And Methods For The Production Thereof Klimanskaya 2010 0 HOXB4 644 chr01q 7770165 7770213 3500172898 48 7770165 7770213 8421504 1 48 0 p 350017289800015006 0-48 Treatment of cancer via targeting of il-13 receptor-alpha2 Strober 2011 0 MIR615 644 chr01q 7770165 7770213 3500170470 48 7770165 7770213 8421504 1 48 0 p 350017047000015003 0-48 A highly effective and long-lasting inhibition of miRNAs with PNA-based antisense oligonucleotides. - ResearchGate .researchgate.net 0 0 HOXB4 644 chr01q 7770165 7770213 3500168461 48 7770165 7770213 8421504 1 48 0 p 350016846100015000 0-48 Peptides targeted to protein kinase C isoforms and uses thereof Phipps 2011 0 HOXC6 644 chr01q 7770165 7770213 3500166999 48 7770165 7770213 8421504 1 48 0 p 350016699900015013 0-48 Nonviral vectors for delivering polynucleotides Khan 2006 0 HOXB4 644 chr01q 7770165 7770213 3500165478 48 7770165 7770213 8421504 1 48 0 p 350016547800015005 0-48 Compositions And Methods For Detecting And Treating Hiv Infections .freshpatents.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500162909 48 7770165 7770213 8421504 1 48 0 p 350016290900015007 0-48 Modified iRNA agents Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500160787 48 7770165 7770213 8421504 1 48 0 p 350016078700015005 0-48 TOXIN COMPOUNDS WITH ENHANCED MEMBRANE TRANSLOCATION CHARACTERISTICS Fernandez-salas 2008 0 HOXB4 644 chr01q 7770165 7770213 3500160610 48 7770165 7770213 8421504 1 48 0 p 350016061000015004 0-48 METHOD FOR TREATING OR PREVENTING BLADDER CANCER USING THE DEPDC1 POLYPEPTIDE Nakamura 2009 0 HOXB4 644 chr01q 7770165 7770213 3500158535 48 7770165 7770213 8421504 1 48 0 p 350015853500015002 0-48 Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof Lee 2008 0 HOXB5 644 chr01q 7770165 7770213 3500157819 48 7770165 7770213 8421504 1 48 0 p 350015781900015002 0-48 Oligonucleotide Compositions with Enhanced Efficiency Woolf 2009 0 HOXB4 644 chr01q 7770165 7770213 3500157203 48 7770165 7770213 8421504 1 48 0 p 350015720300015004 0-48 Perde1588292657 www.scribd.com 0 0 HOXB5 644 chr01q 7770165 7770213 3500154541 48 7770165 7770213 8421504 1 48 0 p 350015454100015025 0-48 Patent Peptide antiestrogen compositions and methods for treating breast cancer (Patent US:6306832) Pietras 2001 0 HOXB4 644 chr01q 7770165 7770213 3500150181 48 7770165 7770213 8421504 1 48 0 p 350015018100015019 0-48 CHEMICALLY MODIFIED OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500148476 48 7770165 7770213 8421504 1 48 0 p 350014847600015034,350014847600015033,350014847600015032 0-48,0-48,0-48 TARGETING OF EWS-FLI1 AS ANTI-TUMOR THERAPY Toretsky 2009 0 HOXB4 644 chr01q 7770165 7770213 3500147023 48 7770165 7770213 8421504 1 48 0 p 350014702300015003,350014702300015002 0-48,6-54 Agent for inhibiting development or progress of proliferative diseases and especially cancer diseases and pharmaceutical composition containing said agent Juping 2005 0 HOXB4 644 chr01q 7770165 7770213 3500142737 48 7770165 7770213 8421504 1 48 0 p 350014273700015003 0-48 TREATING OR PREVENTING CANCERS OVER-EXPRESSING REG4 OR KIAA0101 - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500140678 48 7770165 7770213 8421504 1 48 0 p 350014067800015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500139233 48 7770165 7770213 8421504 1 48 0 p 350013923300015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7538211) Benedict 2009 0 HOXB4 644 chr01q 7770165 7770213 3500139027 48 7770165 7770213 8421504 1 48 0 p 350013902700015014 0-48 Erap1由来ペプチド及びその使用 Katagiri 2013 0 HOXB4 644 chr01q 7770165 7770213 3500138929 48 7770165 7770213 8421504 1 48 0 p 350013892900015002,350013892900015136 0-48,0-45 Secretion System and Methods for its Use - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500138711 48 7770165 7770213 8421504 1 48 0 p 350013871100015009 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500138434 48 7770165 7770213 8421504 1 48 0 p 350013843400015012,350013843400015011,350013843400015017,350013843400015014 0-48,0-48,0-48,0-48 DISHEVELED PDZ MODULATORS - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500136130 48 7770165 7770213 8421504 1 48 0 p 350013613000015009 0-48 MICELLIC ASSEMBLIES - UNIVERSITY OF WASHINGTON www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500132886 48 7770165 7770213 8421504 1 48 0 p 350013288600015006 0-48 MODIFIED iRNA AGENTS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500132386 48 7770165 7770213 8421504 1 48 0 p 350013238600015006,350013238600015020,350013238600015011 0-48,0-48,0-48 散乱蛋白pdz调节剂 Zhang Ying Nan 2009 0 644 chr01q 7770165 7770213 3500130575 48 7770165 7770213 8421504 1 48 0 p 350013057500015008 0-48 IMMUNOGENIC POLYPEPTIDES AND MONOCLONAL ANTIBODIES - Sanofi Pasteur Limited www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500127918 48 7770165 7770213 8421504 1 48 0 p 350012791800015000 0-48 Patent PNA conjugate for the treatment of diseases associated with HIV (Patent US:7563761) Braun 2009 0 MIR615 644 chr01q 7770165 7770213 3500127054 48 7770165 7770213 8421504 1 48 0 p 350012705400015005 0-48 Therapeutic compositions Manoharan 2013 0 HOXC6 644 chr01q 7770165 7770213 3500126353 48 7770165 7770213 8421504 1 48 0 p 350012635300015004 0-48 Multifunctional magnetic nanoparticle probes for intracellular molecular imaging and monitoring Bao 2003 0 MIR615 644 chr01q 7770165 7770213 3500125474 48 7770165 7770213 8421504 1 48 0 p 350012547400015011,350012547400015012,350012547400015003,350012547400015084,350012547400015082,350012547400015081 0-48,0-48,0-45,27-72,18-63,15-60 PEPTIDE OLIGONUCLEOTIDE CONJUGATES - AVI BIOPHARMA, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500124891 48 7770165 7770213 8421504 1 48 0 p 350012489100015004 0-48 16822931 10.1124/mol.105.021741 1521-0111 (Online) Molecular Pharmacology Caveolin-1 Regulates Store-Operated Ca2+ Influx by Binding of Its Scaffolding Domain to Transient Receptor Potential Channel-1 in Endothelial Cells Kwiatek 2006 0 HOXB4 644 chr01q 7770165 7770213 3500122903 48 7770165 7770213 8421504 1 48 0 p 350012290300015013 0-48 20934997 10.3324/haematol.2010.030924 0390-6078 Haematologica The impact of human leukocyte antigen (HLA) micropolymorphism on ligand specificity within the HLA-B*41 allotypic family Bade-Doding 2011 6 HOXB4 644 chr01q 7770165 7770213 3500120941 48 7770165 7770213 8421504 1 48 0 p 350012094100015001 0-48 18160487 10.1152/ajpcell.00360.2007 American Journal of Physiology - Cell Physiolog Role of PKC-δ on substance P-induced chemokine synthesis in pancreatic acinar cells Ramnath 2008 0 HOXB4 644 chr01q 7770165 7770213 3500119318 48 7770165 7770213 8421504 1 48 0 p 350011931800015005 0-48 Patent Therapeutic compositions (Patent US:8445665) Manoharan 2013 0 HOXB4 644 chr01q 7770165 7770213 3500117014 48 7770165 7770213 8421504 1 48 0 p 350011701400015123 0-48 Patent Peptide compositions for targeting adipose tissue (Patent US:8067377) Arap 2011 0 HOXB4 644 chr01q 7770165 7770213 3500116776 48 7770165 7770213 8421504 1 48 0 p 350011677600015000,350011677600015001 0-48,0-48 20427663 10.1523/JNEUROSCI.5094-09.2010 0270-6474 The Journal of Neuroscience Dysregulation of Dopamine Transporters via Dopamine D2 Autoreceptors Triggers Anomalous Dopamine Efflux Associated with Attention-Deficit Hyperactivity Disorder Bowton 2010 7 HOXC6 644 chr01q 7770165 7770213 3500114543 48 7770165 7770213 8421504 1 48 0 p 350011454300015005 0-48 Therapeutic compositions Manoharan 2010 0 HOXB4 644 chr01q 7770165 7770213 3500113737 48 7770165 7770213 8421504 1 48 0 p 350011373700015001 0-48 主题：CD40 | 医源世界 www.39kf.com 0 0 MIR615 644 chr01q 7770165 7770213 3500111505 48 7770165 7770213 8421504 1 48 0 p 350011150500015007,350011150500015000 3-51,3-51 Voltage dependent anion channel (vdac1) compositions and methods of use thereof for regulating apoptosis Shoshan-Barmatz 2011 0 HOXC6 644 chr01q 7770165 7770213 3500110810 48 7770165 7770213 8421504 1 48 0 p 350011081000015001,350011081000015000 3-51,3-51 TLR2-dependenteosinophilinteractionswithmycobacteria:roleof -defensins tologylibrary.org 0 0 MIR615 644 chr01q 7770165 7770213 3500110086 48 7770165 7770213 8421504 1 48 0 p 350011008600015000 0-48 Patent Pna conjugate for the treatment of diseases associated with hiv (Patent EP:1404373) Braun 2008 0 HOXC6 644 chr01q 7770165 7770213 3500109228 48 7770165 7770213 8421504 1 48 0 p 350010922800015008,350010922800015009 0-48,63-111 12138200 10.1128/MCB.22.16.5897-5911.2002 0270-7306 Molecular and Cellular Biology Site-Directed Perturbation of Protein Kinase C- Integrin Interaction Blocks Carcinoma Cell Chemotaxis Parsons 2002 6 HOXC6 644 chr01q 7770165 7770213 3500108397 48 7770165 7770213 8421504 1 48 0 p 350010839700015005 0-48 Methods and compositions for delivering polynucleotides Khan 2006 0 HOXB5 644 chr01q 7770165 7770213 3500106573 48 7770165 7770213 8421504 1 48 0 p 350010657300015000 0-48 Enhanced efficiency of induced pluripotent stem cell generation - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500106421 48 7770165 7770213 8421504 1 48 0 p 350010642100015093,350010642100015100 3-51,0-48 ISOZYME-SPECIFIC ANTAGONISTS OF PROTEIN KINASE C - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500105384 48 7770165 7770213 8421504 1 48 0 p 350010538400015006 0-48 Activatable toxin complexes comprising a cleavable inhibitory peptide Benhar 2012 0 HOXB4 644 chr01q 7770165 7770213 3500103084 48 7770165 7770213 8421504 1 48 0 p 350010308400015039,350010308400015071 0-48,0-48 ALPHA CONNEXIN C-TERMINAL (ACT) PEPTIDES FOR TREATING AGE-RELATED MACULAR DEGENERATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500102288 48 7770165 7770213 8421504 1 48 0 p 350010228800015005,350010228800015010 0-48,0-45 Antisense compounds which prevent cell death and uses thereof Troy 1997 0 HOXB4 644 chr01q 7770165 7770213 3500101924 48 7770165 7770213 8421504 1 48 0 p 350010192400015000 0-48 Control of apoptosis using a complex of an oligonucleotide and a regulatory peptide Jenkinson 2004 0 HOXB4 644 chr01q 7770165 7770213 3500101748 48 7770165 7770213 8421504 1 48 0 p 350010174800015007,350010174800015006,350010174800015005,350010174800015000,350010174800015009,350010174800015008 3-51,3-51,3-51,3-51,3-51,3-51 VOLTAGE DEPENDENT ANION CHANNEL (VDACl) COMPOSITIONS AND METHODS OF USE THEREOF FOR REGULATING APOPTOSIS Shoshan-Barmatz 2006 0 HOXB4 644 chr01q 7770165 7770213 3500101536 48 7770165 7770213 8421504 1 48 0 p 350010153600015000,350010153600015005 0-48,6-51 Pna-konjugat zur therapie von mit hiv in zusammenhang stehenden erkrankungen Braun 2004 0 HOXB4 644 chr01q 7770165 7770213 3500100804 48 7770165 7770213 8421504 1 48 0 p 350010080400015003 0-48 METHOD OF TREATING NEURODEGENERATIVE DISEASE - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500100085 48 7770165 7770213 8421504 1 48 0 p 350010008500015002 0-48 Targeting the BCL9/B9L Binding Interaction with β-catenin as a Potential Anticancer Strategy by Steven Akira Kawamoto lue.lib.umich.edu 0 0 HOXB4 644 chr01q 7770165 7770213 3500100022 48 7770165 7770213 8421504 1 48 0 p 350010002200015032 0-48 Peptide-dicer substrate rna conjugates as delivery vehicles for sirna Ahmadian 2007 0 HOXB4 644 chr01q 7770165 7770213 3500099731 48 7770165 7770213 8421504 1 48 0 p 350009973100015000 0-48 Patent Pna-konjugat zur therapie von mit hiv in zusammenhang stehenden erkrankungen (Patent EP:1404373) Braun 2008 0 HOXB4 644 chr01q 7770165 7770213 3500099421 48 7770165 7770213 8421504 1 48 0 p 350009942100015001,350009942100015000 15-63,18-66 GENE AMPLIFICATION OF COACTIVATOR COAA AND USES THEREOF - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500096913 48 7770165 7770213 8421504 1 48 0 p 350009691300015065,350009691300015105,350009691300015085 0-48,0-48,0-48 Patent Composition and methods for promoting wound healing and tissue regeneration (Patent US:7786074) Ghatnekar 2010 0 HOXB4 644 chr01q 7770165 7770213 3500096451 48 7770165 7770213 8421504 1 48 0 p 350009645100015001 0-48 Patent Aptamer therapeutics useful in the treatment of complement-related disorders (Patent US:7803931) Benedict 2010 0 HOXC6 644 chr01q 7770165 7770213 3500096113 48 7770165 7770213 8421504 1 48 0 p 350009611300015006 0-48 ALGAL TRANSFORMATION SYSTEMS, COMPOSITIONS AND METHODS Macmillan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500090044 48 7770165 7770213 8421504 1 48 0 p 350009004400015001 0-48 DOI: 10.1093/nar/gkg160 Cellular uptake of Antennapedia Penetratin peptides is a two-step process in which phase transfer precedes a tryptophan-dependent translocation ww.farm.ucl.ac.be 0 0 MIR615 644 chr01q 7770165 7770213 3500089187 48 7770165 7770213 8421504 1 48 0 p 350008918700015004 0-48 Methods and compositions for delivering polynucleotides Khan 2011 0 HOXB4 644 chr01q 7770165 7770213 3500087478 48 7770165 7770213 8421504 1 48 0 p 350008747800015000 0-48 Cell cycle progression proteins Deak 2003 0 HOXB4 644 chr01q 7770165 7770213 3500084148 48 7770165 7770213 8421504 1 48 0 p 350008414800015002 0-48 COMPOSITIONS AND METHODS FOR DETECTING AND TREATING HIV INFECTIONS - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770165 7770213 3500079904 48 7770165 7770213 8421504 1 48 0 p 350007990400015036,350007990400015102 0-48,0-48 COMPOSITIONS AND METHODS FOR PROMOTING WOUND HEALING AND TISSUE REGENERATION - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500079348 48 7770165 7770213 8421504 1 48 0 p 350007934800015019,350007934800015016 0-48,0-48 靶向线粒体的抗肿瘤剂 Jiang Bing Xian 2010 0 HOXB5 644 chr01q 7770165 7770213 3500078577 48 7770165 7770213 8421504 1 48 0 p 350007857700015127 0-48 Human And Mouse Targeting Peptides Identified By Phage Display .freshpatents.com 0 0 MIR615 644 chr01q 7770165 7770213 3500075826 48 7770165 7770213 8421504 1 48 0 p 350007582600015006 0-48 TRANSDUCIBLE POLYPEPTIDES FOR MODIFYING METABOLISM - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500074550 48 7770165 7770213 8421504 1 48 0 p 350007455000015000 0-48 Ttk as tumor marker and therapeutic target for lung cancer Daigo 2008 0 HOXB4 644 chr01q 7770165 7770213 3500073937 48 7770165 7770213 8421504 1 48 0 p 350007393700015000 0-48 Patent Nachweisverfahren für peptide Detection method for peptide (Patent DE:69935313) KEES 2007 0 HOXB4 644 chr01q 7770165 7770213 3500073624 48 7770165 7770213 8421504 1 48 0 p 350007362400015055,350007362400015019,350007362400015056 39-87,36-84,0-48 Inhibitors of the interaction between P53 and MDM2 - Patent # 7083983 - PatentGenius .patentgenius.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500073579 48 7770165 7770213 8421504 1 48 0 p 350007357900015004 0-48 Compositons, methods and kits for real-time nucleic acid analysis in live cells - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500072930 48 7770165 7770213 8421504 1 48 0 p 350007293000015001 0-48 16020665 10.1158/1535-7163.MCT-04-0253 1535-7163 Molecular Cancer Therapeutics Application of thermally responsive polypeptides directed against c-Myc transcriptional function for cancer therapy III 2005 5 HOXB4 644 chr01q 7770165 7770213 3500072678 48 7770165 7770213 8421504 1 48 0 p 350007267800015083 0-48 COMPOSITIONS AND METHODS OF USE OF TARGETING PEPTIDES AGAINST PLACENTA AND ADIPOSE TISSUES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500070167 48 7770165 7770213 8421504 1 48 0 p 350007016700015001 0-48 DOUBLE-STRANDED OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500069838 48 7770165 7770213 8421504 1 48 0 p 350006983800015009 0-48 Retinoic acid receptor beta-2, its antagonists, and gene therapy vectors for the treatment of neurological disorders CORCORAN 2003 0 MIR615 644 chr01q 7770165 7770213 3500068922 48 7770165 7770213 8421504 1 48 0 p 350006892200015001 0-48 22913813 10.1186/1476-4598-11-59 Molecular Cancer Molecular mechanism of cytotoxicity induced by Hsp90-targeted Antp-TPR hybrid peptide in glioblastoma cells Tomohisa 2012 0 MIR615 644 chr01q 7770165 7770213 3500067379 48 7770165 7770213 8421504 1 48 0 p 350006737900015002 0-48 Production of Pluripotent Cells Through Inhibition of Bright/Arid3a Function - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500065094 48 7770165 7770213 8421504 1 48 0 p 350006509400015000 0-48 10.1083/jcb.200211081 The Journal of Cell Biology An essential role for hGle1 nucleocytoplasmic shuttling in mRNA export Frederic 2003 0 HOXC6 644 chr01q 7770165 7770213 3500065002 48 7770165 7770213 8421504 1 48 0 p 350006500200015001 0-48 Use of cytidine deaminase-related agents to promote demethylation and cell reprogramming Blau 2011 0 HOXC6 644 chr01q 7770165 7770213 3500063035 48 7770165 7770213 8421504 1 48 0 p 350006303500015001,350006303500015009 0-48,0-45 Double-Stranded Oligonucleotides - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500062703 48 7770165 7770213 8421504 1 48 0 p 350006270300015011 0-48 Di-aliphatic substituted pegylated lipids Manoharan 2013 0 MIR615 644 chr01q 7770165 7770213 3500062415 48 7770165 7770213 8421504 1 48 0 p 350006241500015015 0-48 COMBINATION THERAPIES WITH MITOCHONDRIAL-TARGETED ANTI-TUMOR AGENTS - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500061735 48 7770165 7770213 8421504 1 48 0 p 350006173500015014 0-48 CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500061397 48 7770165 7770213 8421504 1 48 0 p 350006139700015018 0-48 Interaction between the vhl tumour suppressor and hypoxia inducible factor, and assay methods relating thereto Maxwell 2000 0 HOXB5 644 chr01q 7770165 7770213 3500059982 48 7770165 7770213 8421504 1 48 0 p 350005998200015001 0-48 15637154 10.1073/pnas.0407224102 0027-8424 Proceedings of the National Academy of Sciences of the United States of America Dissecting the molecular control of endothelial NO synthase by caveolin-1 using cell-permeable peptides Bernatchez 2005 10 HOXC6 644 chr01q 7770165 7770213 3500051201 48 7770165 7770213 8421504 1 48 0 p 350005120100015003 0-48 PROMOTION OF PEROXISOMAL CATALASE FUNCTION IN CELLS Terlecky 2003 0 HOXC6 644 chr01q 7770165 7770213 3500051060 48 7770165 7770213 8421504 1 48 0 p 350005106000015000 0-48 Patent Method for detecting proteinaceous inhibitors of protein-protein or DNA-protein interactions (Patent US:6610495) Watt 2003 0 HOXC6 644 chr01q 7770165 7770213 3500048303 48 7770165 7770213 8421504 1 48 0 p 350004830300015000 0-48 Ttk as tumor marker and therapeutic target for lung cancer Daigo 2009 0 MIR615 644 chr01q 7770165 7770213 3500047773 48 7770165 7770213 8421504 1 48 0 p 350004777300015027 0-48 BLOCKADE OF TL1A-DR3 INTERACTIONS TO AMELIORATE T CELL MEDIATED DISEASE PATHOLOGY - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500047571 48 7770165 7770213 8421504 1 48 0 p 350004757100015013,350004757100015007 18-66,0-48 MicroRNA antisense PNAs, compositions comprising the same, and methods for using and evaluating the same Park 2012 0 HOXB4 644 chr01q 7770165 7770213 3500046544 48 7770165 7770213 8421504 1 48 0 p 350004654400015010 0-48 CELL-BASED BIOPROCESSING - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500046272 48 7770165 7770213 8421504 1 48 0 p 350004627200015004 0-48 NOVEL Aß-BINDING PROTEIN AND ITS PEPTIDE DERIVATIVES AND USES THEREOF - NATIONAL RESEARCH COUNCIL OF CANADA www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500044825 48 7770165 7770213 8421504 1 48 0 p 350004482500015004 0-48 Double-stranded oligonucleotides Woolf 2003 0 HOXB5 644 chr01q 7770165 7770213 3500043198 48 7770165 7770213 8421504 1 48 0 p 350004319800015014 0-48 Genetically Intact Induced Pluripotent Cells Or Transdifferentiated Cells And Methods For The Production Thereof - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500043019 48 7770165 7770213 8421504 1 48 0 p 350004301900015166,350004301900015168 3-51,3-51 Patent Entzündungshemmende verbindungen und ihre verwendung Anti-inflammatory compounds, and their use (Patent DE:60106423) Findeis 2005 0 MIR615 644 chr01q 7770165 7770213 3500042770 48 7770165 7770213 8421504 1 48 0 p 350004277000015091,350004277000015098 3-51,0-48 Isozyme-specific antagonists of protein kinase C - Patent application www.faqs.org 0 0 HOXB5 644 chr01q 7770165 7770213 3500042218 48 7770165 7770213 8421504 1 48 0 p 350004221800015010 0-48 ERAP1由来ペプチド及びその使用 - IP.com ip.com/patfam/ja/ 0 0 MIR615 644 chr01q 7770165 7770213 3500040558 48 7770165 7770213 8421504 1 48 0 p 350004055800015009 0-48 Hemangio-colony forming cells Lanza 2009 0 MIR615 644 chr01q 7770165 7770213 3500038048 48 7770165 7770213 8421504 1 48 0 p 350003804800015002,350003804800015000 3-51,3-51 Patent Anti-inflammatory compounds and uses thereof (Patent US:7538089) May 2009 0 HOXB4 644 chr01q 7770165 7770213 3500038025 48 7770165 7770213 8421504 1 48 0 p 350003802500015001 0-48 Oligonucleotide Compositions with Enhanced Efficiency - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500037875 48 7770165 7770213 8421504 1 48 0 p 350003787500015004 0-48 Improved lipid formulation Akinc 2012 0 HOXB4 644 chr01q 7770165 7770213 3500032841 48 7770165 7770213 8421504 1 48 0 p 350003284100015000,350003284100015001 3-51,3-51 Treatment Of Human Multiple Myeloma By Curcumin .freshpatents.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500032423 48 7770165 7770213 8421504 1 48 0 p 350003242300015001 0-48 23940795 10.1371/journal.pone.0071957 1932-6203 PLOS ONE PLOS ONE: Phosphorylation of the Actin Binding Protein Drebrin at S647 Is Regulated by Neuronal Activity and PTEN Kreis 2013 4 HOXB4 644 chr01q 7770165 7770213 3500030957 48 7770165 7770213 8421504 1 48 0 p 350003095700015004 0-48 Screening and therapeutic method for nsclc targeting cdca1-kntc2 complex Daigo 2007 0 HOXB4 644 chr01q 7770165 7770213 3500030856 48 7770165 7770213 8421504 1 48 0 p 350003085600015005 0-48 Method for detecting proteinaceous inhibitors of protein-protein or DNA-protein interactions Watt 1999 0 HOXB4 644 chr01q 7770165 7770213 3500030768 48 7770165 7770213 8421504 1 48 0 p 350003076800015016,350003076800015019 0-48,0-48 Patent Mitochondria-targeted anti-tumor agents (Patent US:8466140) Altieri 2013 0 HOXB4 644 chr01q 7770165 7770213 3500030630 48 7770165 7770213 8421504 1 48 0 p 350003063000015000,350003063000015003 3-51,3-51 Anti-inflammatory compounds and uses thereof May 2005 0 HOXB4 644 chr01q 7770165 7770213 3500029692 48 7770165 7770213 8421504 1 48 0 p 350002969200015008 0-48 Immunogenic polypeptides and monoclonal antibodies Brookes 2009 0 HOXB4 644 chr01q 7770165 7770213 3500029444 48 7770165 7770213 8421504 1 48 0 p 350002944400015006 39-87 用于递送治疗剂的新型脂质和组合物 Kai Lan Tuo Ta Ti Er *G*La Ji Fu 2011 0 HOXC6 644 chr01q 7770165 7770213 3500029112 48 7770165 7770213 8421504 1 48 0 p 350002911200015000 0-48 Peptides targeted to protein kinase c isoforms and uses thereof Phipps 2010 0 HOXC6 644 chr01q 7770165 7770213 3500026374 48 7770165 7770213 8421504 1 48 0 p 350002637400015000 0-48 TBC1D7 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR CANCER - ONCOTHERAPY SCIENCE, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500025356 48 7770165 7770213 8421504 1 48 0 p 350002535600015001,350002535600015004 0-48,0-48 International Journal of Medical Sciences www.medsci.org 0 0 HOXB4 644 chr01q 7770165 7770213 3500024469 48 7770165 7770213 8421504 1 48 0 p 350002446900015004 0-48 Erap1-derived peptide and use thereof Katagiri 2013 0 MIR615 644 chr01q 7770165 7770213 3500024102 48 7770165 7770213 8421504 1 48 0 p 350002410200015000 0-48 16301656 0022-1767 The Journal of Immunology Toll-IL-1 Receptor Domain-Containing Adaptor Protein Is Critical for Early Lung Immune Responses against Escherichia coli Lipopolysaccharide and Viable Escherichia coli Jeyaseelan 2005 6 MIR615 644 chr01q 7770165 7770213 3500023336 48 7770165 7770213 8421504 1 48 0 p 350002333600015000 0-48 Immune System Function in Conditions Characterized by Elevated Double Strand Breaks - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770213 3500022904 48 7770165 7770213 8421504 1 48 0 p 350002290400015003 0-48 Assays and methods for determining activity of a therapeutic agent in a subject Sah 2012 0 HOXB5 644 chr01q 7770165 7770213 3500022158 48 7770165 7770213 8421504 1 48 0 p 350002215800015010 0-48 SCREENING AND THERAPEUTIC METHOD FOR NSCLC TARGETING CDCA1-KNTC2 COMPLEX Nakamura 2006 0 MIR615 644 chr01q 7770165 7770213 3500018336 48 7770165 7770213 8421504 1 48 0 p 350001833600015008 0-48 Novel lipids and compositions for the delivery of therapeutics Manoharan 2010 0 MIR615 644 chr01q 7770165 7770213 3500013103 48 7770165 7770213 8421504 1 48 0 p 350001310300015000,350001310300015001 3-51,3-51 18607384 10.1038/ijo.2008.101 0307-0565 International Journal of Obesity Characterization of the human CIDEA promoter in fat cells Pettersson 2008 5 HOXB4 644 chr01q 7770165 7770213 3500011010 48 7770165 7770213 8421504 1 48 0 p 350001101000015007 0-48 Autogene nucleic acids encoding a secretable RNA polymerase Finn 2002 0 HOXB4 644 chr01q 7770165 7770213 3500010947 48 7770165 7770213 8421504 1 48 0 p 350001094700015230,350001094700015229,350001094700015231,350001094700015232 3-51,3-51,0-45,0-45 Anti-inflammatory compounds and uses thereof - Patent # 7049395 - PatentGenius .patentgenius.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500009611 48 7770165 7770213 8421504 1 48 0 p 350000961100015006 0-48 LIGAND-CONJUGATED MONOMERS Manoharan 2012 0 HOXC6 644 chr01q 7770165 7770213 3500009575 48 7770165 7770213 8421504 1 48 0 p 350000957500015005 0-48 PNA conjugate for the treatment of diseases associated with HIV Braun 2002 0 HOXC6 644 chr01q 7770165 7770213 3500008929 48 7770165 7770213 8421504 1 48 0 p 350000892900015006 0-48 iRNA conjugates Manoharan 2004 0 HOXB5 644 chr01q 7770165 7770213 3500008841 48 7770165 7770213 8421504 1 48 0 p 350000884100015000 24-72 18283311 10.1038/sj.bjc.6604268 0007-0920 British Journal of Cancer Double inhibition of XIAP and Bcl-2 axis is beneficial for retrieving sensitivity of renal cell cancer to apoptosis Bilim 2008 5 HOXB5 644 chr01q 7770165 7770213 3500008686 48 7770165 7770213 8421504 1 48 0 p 350000868600015019 3-51 Peptides and aptamers for targeting of neuron or nerves Tsien 2010 0 HOXB5 644 chr01q 7770165 7770213 3500008144 48 7770165 7770213 8421504 1 48 0 p 350000814400015005 3-51 Transgenic mouse models of hepatitis c virus (hcv) and identification of hcv therapeutics Frelin 2006 0 MIR615 644 chr01q 7770165 7770213 3500006423 48 7770165 7770213 8421504 1 48 0 p 350000642300015002 0-48 Compositions and methods for detecting and treating HIV infections - Patent # 7662547 - PatentGenius .patentgenius.com 0 0 HOXB4 644 chr01q 7770165 7770213 3500006066 48 7770165 7770213 8421504 1 48 0 p 350000606600015000 18-66 18073344 10.1261/rna.844108 1355-8382 RNA miR-122 targeting with LNA/2′-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA–peptide conjugates Fabani 2008 5 HOXB4 644 chr01q 7770165 7770213 3500003096 48 7770165 7770213 8421504 1 48 0 p 350000309600015019 0-48 TREATMENT OF DISEASE CONDITIONS VIA ADMINISTRATION OF DNA REPAIR ENZYME - UNIVERSITY OF SOUTH ALABAMA www.sumobrain.com 0 0 HOXC6 644 chr01q 7770165 7770213 3500001458 48 7770165 7770213 8421504 1 48 0 p 350000145800015001 0-48 Cell-penetrating peptides and bioactive cargoes. Strategies and mechanisms. w.diva-portal.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500389892 45 7770165 7770210 8421504 1 45 0 p 350038989200015010 0-45 METHODS AND COMPOUNDS FOR REDUCING INTRACELLULAR LIPID STORAGE - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500366688 45 7770165 7770210 8421504 1 45 0 p 350036668800015052 0-45 Modified Bacteriophage Vectors and Uses Thereof - Patent application www.faqs.org 0 0 HOXB4 644 chr01q 7770165 7770210 3500178016 45 7770165 7770210 8421504 1 45 0 p 350017801600015003 3-48 RGD-independentCellAdhesionviaaTissue Transglutaminase-FibronectinMatrixPromotesFibronectin FibrilDepositionandRequiresSyndecan-4/2and IntegrinCo-signaling S www.jbc.org 0 0 HOXC6 644 chr01q 7770165 7770210 3500158084 45 7770165 7770210 8421504 1 45 0 p 350015808400015009 0-45 Method for Treating and Preventing Ischemia-Reperfusion Injury Using Rna Interfering Agent - Patent application www.faqs.org 0 0 MIR615 644 chr01q 7770165 7770210 3500107575 45 7770165 7770210 8421504 1 45 0 p 350010757500015002 3-48 The Importance of the Tissue Transglutaminase-Fibronectin Heterocomplex in the RGD-independent Cell Adhesion and Fibronectin Matrix Deposition rints.aston.ac.uk 0 0 HOXC6 644 chr01q 7770165 7770210 3500102585 45 7770165 7770210 8421504 1 45 0 p 350010258500015047 0-45 EMBEDDED CHIMERIC PEPTIDE NUCLEIC ACIDS AND USES THEREOF - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770168 7770213 3500412250 45 7770168 7770213 8421504 1 45 0 p 350041225000015006 0-45 SERPINA1 SIRNAS: COMPOSITIONS OF MATTER AND METHODS OF TREATMENT - ALNYLAM PHARMACEUTICALS, INC. www.sumobrain.com 0 0 HOXB4 644 chr01q 7770168 7770213 3500270939 45 7770168 7770213 8421504 1 45 0 p 350027093900015000 0-45 Methods of constructing and screening diverse expression libraries - Patent application www.faqs.org 0 0 HOXC6 644 chr01q 7770168 7770213 3500210061 45 7770168 7770213 8421504 1 45 0 p 350021006100015002 3-48 Methods of constructing and screening diverse expression libraries - US Patent 7270969 Description ww.patentstorm.us 0 0 MIR615 644 chr01q 7771822 7771847 3500454641 25 7771822 7771847 8421504 1 25 0 c 350045464100000005 0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 644 chr01q 7771822 7771847 3500275698 25 7771822 7771847 8421504 1 25 0 c 350027569800000005 0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 645 chr01q 7895611 7895637 3500306361 23 7895611 7895637 8421504 2 17,6 0,20 g 350030636100000240 8-31 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 591 chr02q 840094 840123 3500248155 25 840094 840123 8421504 3 14,4,7 0,17,22 g 350024815500000071 0-25 <HTML> <HEAD> <TITLE>CSM_Contig cDNA Contig-U12483-1

Homology Contig-U12 iol.tsukuba.ac.jp 0 0 598 chr02q 1804322 1804372 3500448531 50 1804322 1804372 8421504 1 50 0 g 350044853100000006 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 600 chr02q 2057422 2072261 3500420073 48 2057422 2072261 8421504 2 23,25 0,14814 c,g 350042007300000000,350042007300000000,350042007300000001 10-33,10-33,5-30 16835438 10.1242/dev.02466 0950-1991 Development A signalling relay involving Nodal and Delta ligands acts during secondary notochord induction in Ciona embryos Hudson 2006 7 600 chr02q 2057422 2072261 3500101262 48 2057422 2072261 8421504 2 23,25 0,14814 c,g 350010126200000000,350010126200000000,350010126200000001 10-33,10-33,5-30 16835438 10.1242/dev.02466 0950-1991 Development A signalling relay involving Nodal and Delta ligands acts during secondary notochord induction in Ciona embryos Hudson 2006 7 600 chr02q 2069424 2070546 3500399464 90 2069424 2070546 8421504 3 54,9,27 0,1059,1095 p 350039946400015028 0-132 lag-1, a gene required for lin-12 and glp-1 signaling in Caenorhabditis elegans, is homologous to human CBF1 and DrosophilaSu(H) ev.biologists.org 0 0 RBPJ 602 chr02q 2261566 2261591 3500324336 25 2261566 2261591 8421504 1 25 0 c 350032433600000000 0-25 10.1371/journal.pbio.0040225 1545-7885 PLOS Biology PLOS Biology: Formation of the Ascidian Epidermal Sensory Neurons: Insights into the Origin of the Chordate Peripheral Nervous System Pasini 2006 0 602 chr02q 2281098 2284008 3500222822 602 2281098 2284008 8421504 5 156,59,155,174,58 0,371,1393,2390,2852 g 350022282200000004,350022282200000012,350022282200000018,350022282200000013,350022282200000011,350022282200000019,350022282200000005,350022282200000020,350022282200000006 14-37,0-851,14-37,0-851,0-851,3-29,3-29,0-27,0-27 ALTERNATIVE OXIDASE AND USES THEREOF - Patent application www.faqs.org 0 0 602 chr02q 2281098 2282594 3500418040 71 2281098 2282594 8421504 2 23,48 0,1448 g 350041804000000004,350041804000000005,350041804000000006 14-37,3-29,0-27 ALTERNATIVE OXIDASE AND USES THEREOF - RUSTIN, Pierre www.sumobrain.com 0 0 602 chr02q 2281098 2282594 3500387891 50 2281098 2282594 8421504 2 23,27 0,1469 g 350038789100000004,350038789100000006 14-37,0-27 10.1038/sj.embor.7400601 EMBO Reports Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration Gerrit 2006 0 602 chr02q 2281098 2282594 3500151360 50 2281098 2282594 8421504 2 23,27 0,1469 g 350015136000000004,350015136000000006 14-37,0-27 Alternative oxidase and uses thereof Frederic 2006 0 602 chr02q 2283966 2283992 3500132578 26 2283966 2283992 8421504 1 26 0 g 350013257800000006 0-26 Ciona intestinalis Alternative Oxidase (AOX) in Drosophila Complements Defects in Mitochondrial Oxidative Phosphorylation download.cell.com 0 0 602 chr02q 2286054 2286078 3500350348 23 2286054 2286078 8421504 2 12,11 0,13 g 350035034800000281 3-39 US Patent # 6,004,924. Protein sequences of serrate gene products - Patents.com www.patents.com 0 0 610 chr02q 3381859 3381964 3500387584 45 3381859 3381964 8421504 4 8,16,6,15 0,10,82,90 g 350038758400000524 44-147 Tag der mündlichen Prüfung: 15.12. 2004 m.opus.hbz-nrw.de 0 0 611 chr02q 3514163 3514188 3500324336 25 3514163 3514188 8421504 1 25 0 c,g 350032433600000001,350032433600000001 0-25,0-25 10.1371/journal.pbio.0040225 1545-7885 PLOS Biology PLOS Biology: Formation of the Ascidian Epidermal Sensory Neurons: Insights into the Origin of the Chordate Peripheral Nervous System Pasini 2006 0 611 chr02q 3514202 3525018 3500437398 360 3514202 3525018 8421504 8 28,32,69,51,1,59,18,102 0,710,802,1419,9703,9839,10387,10714 p 350043739800015001,350043739800015003,350043739800015004,350043739800015015,350043739800015019,350043739800015020 0-60,0-60,0-60,0-60,0-66,0-60 骨形成因子BMPによる骨形成促進におけるSmad8の役割の研究 Author(s) 河合, 伸治 Citation Issue D ary.osaka-u.ac.jp 0 0 611 chr02q 3514202 3515672 3500007790 120 3514202 3515672 8421504 4 28,32,9,51 0,710,862,1419 p 350000779000015001,350000779000015004 0-60,0-60 骨形成因子BMPによる骨形成促進におけるSmad8の役割の研究 Author(s) 河合, 伸治 Citation Issue D ary.osaka-u.ac.jp 0 0 611 chr02q 3514223 3514950 3500455533 45 3514223 3514950 8421504 2 7,38 0,689 p 350045553300015003 0-45 10.1002/ijc.10584 1097-0215 International Journal of Cancer Target validation for genomics using peptide-specific phage antibodies: A study of five gene products overexpressed in colorectal cancer - van Beijnum - 2002 - International Journal of Cancer - Wiley Online Library Beijnum 2002 0 611 chr02q 3515040 3515633 3500442253 45 3515040 3515633 8421504 2 33,12 0,581 p 350044225300015004 3-48 Inhibition Of Smad3 To Prevent Fibrosis And Improve Wound Healing .freshpatents.com 0 0 611 chr02q 3524595 3524967 3500058474 63 3524595 3524967 8421504 2 12,51 0,321 p 350005847400015004,350005847400015005 0-63,0-63 Genetic Characterization and Cloning of Mothers against dpp, a Gene Required for decapentuplegic Function in DrosqPhila melanogaster www.genetics.org 0 0 SMAD5 612 chr02q 3588494 3588554 3500304259 60 3588494 3588554 8421504 1 60 0 g 350030425900000181 0-60 BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 612 chr02q 3610923 3615977 3500157645 51 3610923 3615977 8421504 2 26,25 0,5029 c,g 350015764500000014,350015764500000013,350015764500000013,350015764500000006,350015764500000010,350015764500000012,350015764500000012 7-33,10-36,10-36,13-38,11-34,10-32,10-32 Nox5 forms a functional oligomer mediated by self-association of its dehydrogenase domain. - ResearchGate .researchgate.net 0 0 612 chr02q 3610923 3615977 3500103717 74 3610923 3615977 8421504 3 26,23,25 0,3091,5029 c,g 350010371700000013,350010371700000013,350010371700000014,350010371700000007,350010371700000006,350010371700000010,350010371700000012,350010371700000012 10-36,10-36,7-33,0-23,13-38,11-34,10-32,10-32 21319793 10.1021/bi1020088 Biochemistry Nox5 forms a functional oligomer mediated by self-association of its dehydrogenase domain Tsukasa 2011 0 612 chr02q 3610923 3615977 3500084509 93 3610923 3615977 8421504 3 20,48,25 0,3043,5029 p,c,g 350008450900000001,350008450900000001,350008450900015001,350008450900000000 16-36,16-36,0-48,11-36 Novel Ion Channel-like Polypeptide And Use Thereof .freshpatents.com 0 0 612 chr02q 3610923 3615977 3500056038 118 3610923 3615977 8421504 5 20,22,28,23,25 0,1339,1645,4502,5029 c,g 350005603800000001,350005603800000001,350005603800000012,350005603800000012,350005603800000005,350005603800000006,350005603800000011,350005603800000000 16-36,16-36,0-22,0-22,0-28,0-28,0-23,11-36 Supplementary figures www.nature.com 0 0 612 chr02q 3613968 3615977 3500309911 49 3613968 3615977 8421504 2 25,24 0,1985 c,g 350030991100000002,350030991100000000 16-41,13-37 17487283 10.1371/journal.pone.0000440 1932-6203 PLOS ONE PLOS ONE: Engineering and Characterization of an Enhanced Fluorescent Protein Voltage Sensor Dimitrov 2007 4 612 chr02q 3614368 3615401 3500284481 59 3614368 3615401 8421504 2 30,29 0,1004 c 350028448100000005,350028448100000004,350028448100000003,350028448100000002 0-30,0-30,0-29,0-29 Journal of Physiology lib.ajaums.ac.ir 0 0 612 chr02q 3615953 3615977 3500467039 24 3615953 3615977 8421504 1 24 0 g 350046703900000002 13-37 19234605 10.1371/journal.pone.0004555 1932-6203 PLOS ONE PLOS ONE: Spectrally-Resolved Response Properties of the Three Most Advanced FRET Based Fluorescent Protein Voltage Probes Mutoh 2009 4 621 chr02q 4824274 4824299 3500173555 25 4824274 4824299 8421504 1 25 0 c,g 350017355500000001,350017355500000001 0-25,0-25 Gene expression proﬁles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks ev.biologists.org 0 0 621 chr02q 4824274 4824299 3500123927 25 4824274 4824299 8421504 1 25 0 c,g 350012392700000001,350012392700000001 0-25,0-25 15269171 10.1242/dev.01270 0950-1991 Development Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks Imai 2004 7 624 chr02q 5120658 5120708 3500448531 50 5120658 5120708 8421504 1 50 0 g 350044853100000008 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 631 chr02q 6152400 6152534 3500228956 25 6152400 6152534 8421504 2 16,9 0,125 c 350022895600000015 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 631 chr02q 6152400 6152534 3500193888 25 6152400 6152534 8421504 2 16,9 0,125 c 350019388800000015 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 636 chr02q 6784495 6784777 3500316042 42 6784495 6784777 8421504 2 21,21 0,261 g 350031604200000018,350031604200000019 0-21,0-21 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 639 chr02q 7105485 7105514 3500201353 24 7105485 7105514 8421504 2 12,12 0,17 g 350020135300000001 12-44 10925294 0022-1767 The Journal of Immunology Distinct Pathways of Mannan-Binding Lectin (MBL)- and C1-Complex Autoactivation Revealed by Reconstitution of MBL with Recombinant MBL-Associated Serine Protease-2 Vorup-Jensen 2000 6 644 chr02q 7797467 7797501 3500304259 34 7797467 7797501 8421504 1 34 0 g 350030425900000175 0-34 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 589 chr03p 549157 549190 3500065677 33 549157 549190 8421504 1 33 0 g 350006567700000093 0-33 Phylogenetic Position of Foraminifera Inferred from LSU rRNA Gene Sequences brary.arizona.edu 0 0 593 chr03p 1131741 1131791 3500448531 50 1131741 1131791 8421504 1 50 0 g 350044853100000011 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 594 chr03p 1211000 1211050 3500448531 50 1211000 1211050 8421504 1 50 0 g 350044853100000010 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 597 chr03p 1582193 1582243 3500448531 50 1582193 1582243 8421504 1 50 0 g 350044853100000012 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 604 chr03p 2613935 2613959 3500216241 23 2613935 2613959 8421504 2 16,7 0,17 g 350021624100002393 19-42 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 606 chr03p 2762666 2765423 3500233724 2743 2762666 2765423 8421504 6 5,134,7,76,364,2157 0,6,141,149,233,600 p,c,g 350023372400000031,350023372400000030,350023372400015021,350023372400000029,350023372400000029,350023372400000004,350023372400000004,350023372400015020,350023372400000028,350023372400015000,350023372400000003,350023372400015019,350023372400000027,350023372400000027,350023372400015018,350023372400000026,350023372400000026,350023372400000025,350023372400000025,350023372400015017,350023372400015016,350023372400000024,350023372400000024,350023372400000023,350023372400000023,350023372400000022,350023372400000022,350023372400015015,350023372400015014,350023372400000021,350023372400000021,350023372400015004,350023372400000020,350023372400000020,350023372400015013,350023372400000019,350023372400000018,350023372400000018,350023372400015011,350023372400000017,350023372400000017,350023372400015010,350023372400000016,350023372400000016,350023372400015009,350023372400000015,350023372400000015,350023372400015008,350023372400000014,350023372400000014,350023372400015007,350023372400000013,350023372400015006,350023372400000012,350023372400000012,350023372400015005,350023372400000011,350023372400000011,350023372400000000,350023372400000010,350023372400000010,350023372400000009,350023372400000009,350023372400000001,350023372400015002,350023372400000008,350023372400000008,350023372400000002,350023372400000002,350023372400000007,350023372400000007,350023372400015001,350023372400000006 0-598,0-77,0-81,0-80,0-80,0-27,0-27,0-78,0-80,0-87,0-27,0-81,0-80,0-80,0-81,0-80,0-80,0-80,0-80,0-78,0-81,0-80,0-80,0-80,0-80,0-80,0-80,0-78,0-81,0-80,0-80,0-132,0-80,0-80,0-78,0-80,0-80,0-80,0-87,0-80,0-80,0-78,0-80,0-80,0-81,0-80,0-80,0-81,0-80,0-80,0-78,0-80,0-81,0-80,0-80,0-81,0-80,0-80,0-30,0-80,0-80,0-81,0-81,0-30,0-81,0-80,0-80,0-24,0-24,0-80,0-80,0-78,0-240 The hsp70 protein is involved in the acquisition of gamete self-sterility in the ascidian Ciona intestinalis ev.biologists.org 0 0 606 chr03p 2764728 2764776 3500270521 48 2764728 2764776 8421504 1 48 0 p 350027052100015016 27-75 PROTEÔMICA DIFERENCIAL EM CLONES DE www.tede.ufv.br 0 0 SNORD48 607 chr03p 2940157 2940181 3500216241 23 2940157 2940181 8421504 2 11,12 0,12 g 350021624100000649 15-38 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 608 chr03p 3094301 3094328 3500341316 24 3094301 3094328 8421504 2 7,17 0,10 g 350034131600000003 1-25 21787419 10.1186/gb-2011-12-7-r66 1465-6906 Genome Biology The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology Manning 2011 0 608 chr03p 3094301 3094328 3500028733 24 3094301 3094328 8421504 2 7,17 0,10 g 350002873300000003 1-25 The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology genomebiology.com 0 0 615 chr03p 4018365 4018415 3500448531 50 4018365 4018415 8421504 1 50 0 g 350044853100000013 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 618 chr03p 4445924 4445947 3500393134 23 4445924 4445947 8421504 1 23 0 c 350039313400000015 5-28 tsjok45 | Tsjok's blog | Pagina 29 k45.wordpress.com 0 0 590 chr03q 775318 775342 3500214186 23 775318 775342 8421504 2 9,14 0,10 g 350021418600000355 8-31 Highly conserved genes and their use to generate probes and primers for detection of microorganisms - Patent application www.faqs.org 0 0 591 chr03q 866320 866370 3500448531 50 866320 866370 8421504 1 50 0 g 350044853100000014 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 592 chr03q 978809 979705 3500030773 162 978809 979705 8421504 3 105,6,51 0,836,845 p 350003077300015102,350003077300015101 0-111,0-51 Patent Protein kinase stress-related proteins and methods of use in plants (Patent CA:2405750) Da 2013 0 592 chr03q 982179 982727 3500220671 75 982179 982727 8421504 2 51,24 0,524 p 350022067100015075,350022067100015038 15-87,18-87 Synthetic or natural peptides binding protein phosphatase 2A, identification method and uses Garcia 2006 0 592 chr03q 982179 982721 3500390334 69 982179 982721 8421504 2 51,18 0,524 p 350039033400015039 18-87 2 331 730 digital.csic.es 0 0 592 chr03q 982179 982721 3500379840 69 982179 982721 8421504 2 51,18 0,524 p 350037984000015033 18-87 Patent Peptides synthetiques ou naturels liant la proteine phosphatase 2a, methode d'identification et utilisations (Patent EP:1530584) Cayla 2009 0 592 chr03q 982179 982721 3500369732 69 982179 982721 8421504 2 51,18 0,524 p 350036973200015014 18-87 Peptides synthetiques ou naturels liant la proteine phosphatase 2a, methode d'identification et utilisations Cayla 2005 0 592 chr03q 982179 982721 3500306350 69 982179 982721 8421504 2 51,18 0,524 p 350030635000015004 18-87 Patent 结合蛋白磷酸酶2a的合成的或者天然的肽,其鉴定方法以及用途 (Patent CN:1630663) AJia Si Ya 2010 0 592 chr03q 982179 982721 3500271843 69 982179 982721 8421504 2 51,18 0,524 p 350027184300015000 18-87 Patent Synthetic or natural peptides binding protein phosphatase 2A, identification method and uses (Patent CN:1630663) AJia Si Ya 2010 0 592 chr03q 982179 982721 3500267854 69 982179 982721 8421504 2 51,18 0,524 p 350026785400015029 18-87 Patent Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses (Patent EP:1530584) Cayla 2009 0 592 chr03q 982179 982721 3500254195 69 982179 982721 8421504 2 51,18 0,524 p 350025419500015008 18-87 Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses Cayla 2005 0 592 chr03q 982179 982721 3500252207 69 982179 982721 8421504 2 51,18 0,524 p 350025220700015045 18-87 Synthetic or natural peptides binding protein phosphatase 2A, identification method and uses AJia Si Ya 2005 0 592 chr03q 982179 982721 3500229620 69 982179 982721 8421504 2 51,18 0,524 p 350022962000015037 18-87 结合蛋白磷酸酶2a的合成的或者天然的肽,其鉴定方法以及用途 AJia Si Ya 2005 0 592 chr03q 982179 982721 3500179683 69 982179 982721 8421504 2 51,18 0,524 p 350017968300015005 18-87 Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses Cayla 2011 0 592 chr03q 982179 982721 3500148779 69 982179 982721 8421504 2 51,18 0,524 p 350014877900015063 18-87 Patent Synthetic or natural peptides binding protein phosphatase 2A, identification method and uses (Patent US:8299213) Garcia 2012 0 592 chr03q 982179 982721 3500144840 69 982179 982721 8421504 2 51,18 0,524 p 350014484000015039 18-87 Synthetic or natural peptides binding protein phosphatase 2A, identification method and uses - Patent #08299213 w.strutpatent.com 0 0 592 chr03q 1013876 1014020 3500316042 56 1013876 1014020 8421504 2 26,30 0,114 g 350031604200000014,350031604200000015 0-26,0-30 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 593 chr03q 1065336 1065362 3500452602 26 1065336 1065362 8421504 1 26 0 g 350045260200000001 9-35 10.1186/1471-2121-7-40 1471-2121 BMC Cell Biology Evidence that talin alternative splice variants from Ciona intestinalis have different roles in cell adhesion Singiser 2006 3 598 chr03q 1739997 1740020 3500228956 23 1739997 1740020 8421504 1 23 0 c 350022895600000005 0-23 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 598 chr03q 1739997 1740020 3500193888 23 1739997 1740020 8421504 1 23 0 c 350019388800000005 0-23 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 598 chr03q 1759863 1760325 3500120381 57 1759863 1760325 8421504 2 55,2 0,460 p 350012038100015066 78-135 <Html><Title> Complet list of 1mpf hssp file Complet list of cnptia.embrapa.br 0 0 604 chr03q 2494546 2497550 3500419967 161 2494546 2497550 8421504 6 24,29,27,38,20,23 0,166,1045,1132,1178,2981 c,g 350041996700000005,350041996700000004,350041996700000004,350041996700000001,350041996700000013,350041996700000012,350041996700000011,350041996700000000 9-33,10-39,10-39,10-37,4-24,4-24,4-24,10-33 16207759 10.1242/dev.02051 0950-1991 Development Uncoupling heart cell specification and migration in the simple chordate Ciona intestinalis Davidson 2005 7 604 chr03q 2559372 2559397 3500459905 25 2559372 2559397 8421504 1 25 0 c,g 350045990500000000,350045990500000000 0-25,0-25 17720694 10.1242/dev.010140 0950-1991 Development FoxF is essential for FGF-induced migration of heart progenitor cells in the ascidian Ciona intestinalis Beh 2007 7 604 chr03q 2559372 2559397 3500261019 25 2559372 2559397 8421504 1 25 0 c,g 350026101900000000,350026101900000000 0-25,0-25 17720694 10.1242/dev.010140 0950-1991 Development FoxF is essential for FGF-induced migration of heart progenitor cells in the ascidian Ciona intestinalis Beh 2007 7 75 chr03q 2984122 3035754 3500409385 195 2984122 3035754 8421504 8 23,20,28,29,25,26,23,21 0,7667,15454,15620,22607,35970,46993,51611 c,g 350040938500000001,350040938500000001,350040938500000000,350040938500000011,350040938500000003,350040938500000010,350040938500000010,350040938500000004,350040938500000012,350040938500000013,350040938500000005 0-23,0-23,7-27,0-28,0-29,0-25,0-25,0-22,0-23,0-23,0-21 Tunicate Gonadotropin-Releasing Hormone (GnRH) Peptides Selectively Activate Ciona intestinalis Receptors and the Green Monkey Type II GnRH Receptor .endojournals.org 0 0 611 chr03q 3431123 3431150 3500231482 27 3431123 3431150 8421504 1 27 0 c 350023148200000007 8-35 Nodal regulates neural tube formation in the Ciona intestinalis ir.kochi-u.ac.jp 0 0 615 chr03q 4000985 4001010 3500228956 25 4000985 4001010 8421504 1 25 0 c,g 350022895600000011,350022895600000011 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 615 chr03q 4000985 4001010 3500193888 25 4000985 4001010 8421504 1 25 0 c,g 350019388800000011,350019388800000011 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 616 chr03q 4123571 4123595 3500435971 24 4123571 4123595 8421504 1 24 0 c,g 350043597100000000,350043597100000000 0-24,0-24 Dorsoventral patterning of the vertebrate neural tube is conserved in a protochordate ev.biologists.org 0 0 616 chr03q 4125418 4125466 3500228956 48 4125418 4125466 8421504 1 48 0 c,g 350022895600000022,350022895600000022,350022895600000027,350022895600000027 0-25,0-25,0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 616 chr03q 4125418 4125466 3500193888 48 4125418 4125466 8421504 1 48 0 c 350019388800000022,350019388800000027 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 616 chr03q 4135745 4135772 3500214186 24 4135745 4135772 8421504 2 14,10 0,17 g 350021418600001149 15-39 Highly conserved genes and their use to generate probes and primers for detection of microorganisms - Patent application www.faqs.org 0 0 616 chr03q 4142675 4142705 3500304259 30 4142675 4142705 8421504 1 30 0 g 350030425900000177 0-30 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 616 chr03q 4147837 4147867 3500404557 26 4147837 4147867 8421504 3 6,7,13 0,9,17 g 350040455700000028 3-36 15769737 10.1074/jbc.M500804200 0021-9258 Journal of Biological Chemistry Human Mitochondrial mRNAs Are Stabilized with Polyadenylation Regulated by Mitochondria-specific Poly(A) Polymerase and Polynucleotide Phosphorylase Nagaike 2005 5 617 chr03q 4228753 4228803 3500448531 50 4228753 4228803 8421504 1 50 0 g 350044853100000015 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 621 chr03q 4793204 4793228 3500459869 23 4793204 4793228 8421504 2 16,7 0,17 g 350045986900001188 0-23 Highly Conserved Genes And Their Use To Generate Probes And Primers For Detection Of Microorganisms www.docstoc.com 0 0 628 chr03q 5662791 5662971 3500316042 38 5662791 5662971 8421504 2 19,19 0,161 g 350031604200000006,350031604200000007 0-19,0-19 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 594 chr04q 1241588 1241613 3500228956 25 1241588 1241613 8421504 1 25 0 g 350022895600000025 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 594 chr04q 1241588 1241613 3500193888 25 1241588 1241613 8421504 1 25 0 g 350019388800000025 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 598 chr04q 1812288 1812313 3500228956 25 1812288 1812313 8421504 1 25 0 c 350022895600000000 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 598 chr04q 1812288 1812313 3500193888 25 1812288 1812313 8421504 1 25 0 c,g 350019388800000000,350019388800000000 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 9 chr04q 3144354 3151766 3500062816 61 3144354 3151766 8421504 2 30,31 0,7381 g 350006281600000016,350006281600000015 8-38,38-69 ScienceDirect.com - Current Biology - Ascidian prickle Regulates Both Mediolateral and Anterior-Posterior Cell Polarity of Notochord Cells sciencedirect.com 0 0 609 chr04q 3194796 3194846 3500448531 50 3194796 3194846 8421504 1 50 0 g 350044853100000017 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 609 chr04q 3255545 3255595 3500448531 50 3255545 3255595 8421504 1 50 0 g 350044853100000018 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 617 chr04q 4273768 4274938 3500327602 43 4273768 4274938 8421504 3 22,14,7 0,988,1163 c,g 350032760200000027,350032760200000028,350032760200000020,350032760200000020,350032760200000019 0-22,20-42,9-31,9-31,14-35 20419150 10.1371/journal.pgen.1000912 PLoS Genetics A cis-Regulatory Signature for Chordate Anterior Neuroectodermal Genes Maximilian 2010 0 617 chr04q 4275756 4276914 3500228956 25 4275756 4276914 8421504 2 17,8 0,1150 c 350022895600000018 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 617 chr04q 4275756 4276914 3500193888 25 4275756 4276914 8421504 2 17,8 0,1150 c 350019388800000018 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 617 chr04q 4291065 4291387 3500305932 322 4291065 4291387 8421504 1 322 0 g 350030593200000086,350030593200000047 0-322,0-21 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 620 chr04q 4634240 4634265 3500228956 25 4634240 4634265 8421504 1 25 0 g 350022895600000007 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 620 chr04q 4634240 4634265 3500193888 25 4634240 4634265 8421504 1 25 0 g 350019388800000007 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 621 chr04q 4767167 4767190 3500405834 23 4767167 4767190 8421504 1 23 0 g 350040583400000008 7-30 10.1002/dvdy.20849 1097-0177 Developmental Dynamics Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis - Myohara - 2006 - Developmental Dynamics - Wiley Online L Myohara 2006 0 628 chr04q 5703873 5703898 3500228956 25 5703873 5703898 8421504 1 25 0 c 350022895600000024 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 628 chr04q 5703873 5703898 3500193888 25 5703873 5703898 8421504 1 25 0 c 350019388800000024 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 633 chr04q 6327288 6327338 3500448531 50 6327288 6327338 8421504 1 50 0 g 350044853100000019 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 586 chr05q 237878 237903 3500228956 25 237878 237903 8421504 1 25 0 g 350022895600000017 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 586 chr05q 237878 237903 3500193888 25 237878 237903 8421504 1 25 0 g 350019388800000017 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 591 chr05q 870691 870956 3500305932 265 870691 870956 8421504 1 265 0 g 350030593200000091,350030593200000056,350030593200000057 0-265,0-21,0-22 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 592 chr05q 991240 991290 3500448531 50 991240 991290 8421504 1 50 0 g 350044853100000020 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 594 chr05q 1260538 1260680 3500030629 45 1260538 1260680 8421504 2 18,27 0,115 p 350003062900015018 0-45 CELL ADHESION INHIBITOR AND APPLICATIONS THEREOF - Patent application www.faqs.org 0 0 595 chr05q 1389842 1389873 3500304259 26 1389842 1389873 8421504 3 15,6,5 0,19,26 g 350030425900000782,350030425900000118,350030425900000228 13-39,12-38,11-37 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 602 chr05q 2254394 2260116 3500416348 240 2254394 2260116 8421504 4 39,111,30,60 0,1290,1709,5662 p 350041634800015052,350041634800015091,350041634800015079,350041634800015036 0-213,0-75,36-90,36-96 KURENAI : Kyoto University Research Information Repository lib.kyoto-u.ac.jp 0 0 602 chr05q 2282922 2282948 3500304259 26 2282922 2282948 8421504 1 26 0 g 350030425900000171 0-26 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 613 chr05q 3701632 3701656 3500459627 23 3701632 3701656 8421504 2 17,6 0,18 g 350045962700000068 0-23 METHODS OF INCREASING GENE EXPRESSION THROUGH RNA PROTECTION - Patent application www.faqs.org 0 0 613 chr05q 3708374 3708471 3500228956 50 3708374 3708471 8421504 2 25,25 0,72 c,g 350022895600000026,350022895600000026,350022895600000006 0-25,0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 613 chr05q 3708374 3708471 3500193888 50 3708374 3708471 8421504 2 25,25 0,72 c,g 350019388800000026,350019388800000026,350019388800000006 0-25,0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 613 chr05q 3708446 3708471 3500454641 25 3708446 3708471 8421504 1 25 0 c,g 350045464100000011,350045464100000011 0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 613 chr05q 3708446 3708471 3500275698 25 3708446 3708471 8421504 1 25 0 c 350027569800000011 0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 614 chr05q 3826104 3828041 3500060964 45 3826104 3828041 8421504 2 3,42 0,1895 p 350006096400015057 3-48 METHODS TO IDENTIFY COMPOUNDS USEFUL FOR TUMOR SENSITIZATION TO DNA DAMAGE - Patent application www.faqs.org 0 0 614 chr05q 3826104 3828041 3500036459 45 3826104 3828041 8421504 2 3,42 0,1895 p 350003645900015057 0-45 METHODS TO IDENTIFY COMPOUNDS USEFUL FOR TUMOR SENSITIZATION TO DNA DAMAGE - Patent application www.faqs.org 0 0 614 chr05q 3880500 3880524 3500362691 23 3880500 3880524 8421504 2 17,6 0,18 g 350036269100000014 0-23 Highly polymorphic microsatellites 00Graphicraft Limited, Hong Kong in the lacertid Gallotia galloti ents.plant.wur.nl 0 0 615 chr05q 3989735 3990536 3500416406 40 3989735 3990536 8421504 2 20,20 0,781 c,g 350041640600000001,350041640600000001,350041640600000000,350041640600000000 0-20,0-20,0-20,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 618 chr05q 4444451 4444788 3500166513 102 4444451 4444788 8421504 2 55,47 0,290 p 350016651300015090,350016651300015007,350016651300015132 0-60,0-60,0-60 Isolation and Functional Characterization of a Dioxin-Inducible CYP1A Regulatory Region From Zebrafish ( Gary T. ZeRuth A dissertation submitted in partial fulfillment gradworks.umi.com 0 0 618 chr05q 4444457 4444752 3500099796 60 4444457 4444752 8421504 2 49,11 0,284 p 350009979600015053 0-60 “Clonagem e Expressão do Fator 1 Humano Induzível por Hipóxia (HIF-1) na Levedura Saccharomyces cerevisiae”. bdtd.bce.unb.br 0 0 618 chr05q 4444457 4444752 3500020367 60 4444457 4444752 8421504 2 49,11 0,284 p 350002036700015053 0-60 “Clonagem e Expressão do Fator 1 Humano Induzível por Hipóxia (HIF-1) na Levedura Saccharomyces cerevisiae”. itorio.bce.unb.br 0 0 618 chr05q 4444493 4444776 3500396645 48 4444493 4444776 8421504 2 13,35 0,248 p 350039664500015032 0-48 Process for detecting effectors of intra- and/or intercellular protein-protein interactions Hagenmaier 1998 0 618 chr05q 4444493 4444776 3500087877 48 4444493 4444776 8421504 2 13,35 0,248 p 350008787700015019 0-48 Verfahren zum nachweis für effektoren intra- und/oder interzellulärer protein-protein-wechselwirkungen Hagenmaier 1998 0 620 chr05q 4591834 4591859 3500228956 25 4591834 4591859 8421504 1 25 0 c 350022895600000009 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 620 chr05q 4591834 4591859 3500193888 25 4591834 4591859 8421504 1 25 0 c 350019388800000009 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 623 chr05q 5020528 5020554 3500363160 26 5020528 5020554 8421504 1 26 0 c 350036316000000001 9-35 22627287 10.1242/dev.078485 0950-1991 Development FGF signaling establishes the anterior border of the Ciona neural tube Wagner 2012 7 623 chr05q 5020547 5020572 3500454753 25 5020547 5020572 8421504 1 25 0 c,g 350045475300000002,350045475300000002 0-25,0-25 20530547 10.1242/dev.045302 Development (Cambridge, England) doublesex/mab3 related-1 (dmrt1) is essential for development of anterior neural plate derivatives in Ciona Jason July 0 623 chr05q 5020547 5020572 3500428500 25 5020547 5020572 8421504 1 25 0 c,g 350042850000000002,350042850000000002 0-25,0-25 20530547 10.1242/dev.045302 0950-1991 Development doublesex/mab3 related-1 (dmrt1) is essential for development of anterior neural plate derivatives in Ciona Tresser 2010 7 625 chr05q 5263674 5263698 3500280150 24 5263674 5263698 8421504 1 24 0 g 350028015000000001 6-36 19304844 10.1128/JB.01628-08 0021-9193 Journal of Bacteriology Biochemical Analysis of a β-d-Xylosidase and a Bifunctional Xylanase-Ferulic Acid Esterase from a Xylanolytic Gene Cluster in Prevotella ruminicola 23 Dodd 2009 4 625 chr05q 5263674 5263698 3500016852 24 5263674 5263698 8421504 1 24 0 g 350001685200000001 6-36 19304844 10.1128/JB.01628-08 Journal of Bacteriology Biochemical Analysis of a β-d-Xylosidase and a Bifunctional Xylanase-Ferulic Acid Esterase from a Xylanolytic Gene Cluster in Prevotella ruminicola 23 Dylan 2009 0 626 chr05q 5457675 5464818 3500238085 85 5457675 5464818 8421504 3 36,20,29 0,2998,7114 c,g 350023808500000005,350023808500000001,350023808500000001,350023808500000004,350023808500000004 8-44,0-20,0-20,17-46,17-46 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 626 chr05q 5457675 5464818 3500185760 85 5457675 5464818 8421504 3 36,20,29 0,2998,7114 c,g 350018576000000005,350018576000000001,350018576000000001,350018576000000004,350018576000000004 8-44,0-20,0-20,17-46,17-46 16449567 10.1242/jeb.02032 0022-0949 Journal of Experimental Biology A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit Salvador-Recatala 2006 3 626 chr05q 5457675 5464818 3500119552 768 5457675 5464818 8421504 7 75,168,108,71,70,125,151 0,2880,3593,4333,5131,6273,6992 p,c,g 350011955200000005,350011955200015096,350011955200015091,350011955200000001,350011955200000001,350011955200015086,350011955200015081,350011955200015105,350011955200015101,350011955200015103,350011955200000004,350011955200000004 8-44,0-90,0-240,0-20,0-20,0-240,0-168,0-120,0-105,0-117,17-46,17-46 A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit eb.biologists.org 0 0 631 chr05q 6060647 6060927 3500260141 26 6060647 6060927 8421504 2 6,20 0,260 c 350026014100000267 0-26 <HTML> <HEAD><TITLE>Show BLAST File

CSM_Contig cDNA Contig-U12483-1
Homology Contig-U12 iol.tsukuba.ac.jp 0 0 630 chr07q 6023393 6023473 3500144883 23 6023393 6023473 8421504 3 10,12,1 0,13,79 c 350014488300000136 3-26 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 634 chr07q 6509064 6509089 3500332793 25 6509064 6509089 8421504 1 25 0 g 350033279300000044 1-26 CENOME RESEARCH Volume 15, Issue 5: ARTICLES 005.pasteur.ac.ir 0 0 635 chr07q 6616813 6616838 3500395481 25 6616813 6616838 8421504 1 25 0 g 350039548100000063 4-42 Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius .patentgenius.com 0 0 639 chr07q 7184955 7184978 3500144883 23 7184955 7184978 8421504 1 23 0 g 350014488300001119 6-29 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 588 chr08q 441653 443306 3500041004 56 441653 443306 8421504 2 29,27 0,1626 g 350004100400000000,350004100400000001 0-29,0-27 22536431 10.1371/journal.pone.0035731 1932-6203 PLOS ONE PLOS ONE: New Insights into the Evolution of Metazoan Tyrosinase Gene Family Esposito 2012 4 590 chr08q 726643 726693 3500448531 50 726643 726693 8421504 1 50 0 g 350044853100000031 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 598 chr08q 1747666 1747721 3500304259 55 1747666 1747721 8421504 1 55 0 g 350030425900000157 0-55 BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 604 chr08q 2582225 2582252 3500272711 24 2582225 2582252 8421504 3 14,4,6 0,15,21 g 350027271100000002 1-25 MOLECULAR ANALYSIS OF PLACODAL DEVELOPMENT IN ZEBRAFISH pository.tamu.edu 0 0 605 chr08q 2718580 2718607 3500144883 23 2718580 2718607 8421504 2 10,13 0,14 g 350014488300000322 3-34 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 606 chr08q 2760349 2773876 3500363160 52 2760349 2773876 8421504 2 27,25 0,13502 c,g 350036316000000011,350036316000000011,350036316000000010 10-37,10-37,10-35 22627287 10.1242/dev.078485 0950-1991 Development FGF signaling establishes the anterior border of the Ciona neural tube Wagner 2012 7 607 chr08q 2994550 2997578 3500231482 47 2994550 2997578 8421504 2 24,23 0,3005 c,g 350023148200000000,350023148200000001,350023148200000001 11-35,12-35,12-35 Nodal regulates neural tube formation in the Ciona intestinalis ir.kochi-u.ac.jp 0 0 607 chr08q 2997572 2997597 3500173555 25 2997572 2997597 8421504 1 25 0 c,g 350017355500000002,350017355500000002 0-25,0-25 Gene expression proﬁles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks ev.biologists.org 0 0 607 chr08q 2997572 2997597 3500123927 25 2997572 2997597 8421504 1 25 0 c,g 350012392700000002,350012392700000002 0-25,0-25 15269171 10.1242/dev.01270 0950-1991 Development Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks Imai 2004 7 608 chr08q 3086973 3106409 3500363160 47 3086973 3106409 8421504 2 23,24 0,19412 g 350036316000000009,350036316000000008 9-32,15-39 22627287 10.1242/dev.078485 0950-1991 Development FGF signaling establishes the anterior border of the Ciona neural tube Wagner 2012 7 613 chr08q 3731527 3731557 3500187852 23 3731527 3731557 8421504 3 6,11,6 0,8,24 g 350018785200000010 3-27 22208949 10.1186/1471-2148-11-373 1471-2148 BMC Evolutionary Biology A novel MSMB-related microprotein in the postovulatory egg coats of marsupials Frankenberg 2011 4 619 chr08q 4502434 4502479 3500030046 45 4502434 4502479 8421504 1 45 0 p 350003004600015022 0-45 CARDIOVASCULAR STEM CELLS, METHODS FOR STEM CELL ISOLATION, AND USES THEREOF - Patent application www.faqs.org 0 0 SLC25A37 622 chr08q 4900391 4900439 3500440617 48 4900391 4900439 8421504 1 48 0 p 350044061700015139 0-48 Human Mlr Single Nucleotide Polymorphisms Associated With Dose-dependent Congestive Heart Failure And Methods Of Use Thereof .freshpatents.com 0 0 PPARD 622 chr08q 4900406 4900809 3500072558 48 4900406 4900809 8421504 2 33,15 0,388 p 350007255800015015 0-48 Human Single Nucleotide Polymorphisms Associated With Dose-dependent Weight Gain And Methods Of Use Thereof .freshpatents.com 0 0 PPARG 622 chr08q 4900406 4900809 3500052842 48 4900406 4900809 8421504 2 33,15 0,388 p 350005284200015020 0-48 DMD #24695 A Phosphomimetic Mutation at Threonine-57 Abolishes Transactivation Activity and Alters Nuclear Localization Pattern of Human Pregnane X Receptor aspetjournals.org 0 0 PPARG 622 chr08q 4900409 4900809 3500204768 45 4900409 4900809 8421504 2 30,15 0,385 p 350020476800015008 0-45 Peroxisome proliferator-activated receptor alpha and disorders of lipid metabolism Hudson 2000 0 PPARD 622 chr08q 4900409 4900809 3500080968 45 4900409 4900809 8421504 2 30,15 0,385 p 350008096800015186 0-45 Compositions and methods for treating obesity, obesity related disorders and for inhibiting the infectivity of human immunodeficiency virus - Patent application www.faqs.org 0 0 NR1D2 623 chr08q 5056773 5056801 3500367988 24 5056773 5056801 8421504 3 8,12,4 0,11,24 g 350036798800000000 1-26 Site-specific incorporation of amino acids into molecules Kwon 2008 0 625 chr08q 5341860 5341883 3500408327 23 5341860 5341883 8421504 1 23 0 g 350040832700003288 26-49 GABI Primary Database ( GabiPD ) - Genomanalyse im biologischen System Pflanze gabi.rzpd.de 0 0 641 chr08q 7455275 7455654 3500371398 63 7455275 7455654 8421504 2 51,12 0,367 p 350037139800015000 12-75 ScienceDirect.com - Developmental Biology - The orphan COUP-TF nuclear receptors are markers for neurogenesis from cnidarians to vertebrates sciencedirect.com 0 0 641 chr08q 7455290 7455654 3500140536 48 7455290 7455654 8421504 2 36,12 0,352 p 350014053600015006 0-48 AGENT FOR PROMOTING NEURONAL DIFFERENTIATION AND METHOD THEREFOR - Patent application www.faqs.org 0 0 586 chr09p 207654 207679 3500173555 25 207654 207679 8421504 1 25 0 c 350017355500000000 0-25 Gene expression proﬁles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks ev.biologists.org 0 0 586 chr09p 207654 207679 3500123927 25 207654 207679 8421504 1 25 0 c,g 350012392700000000,350012392700000000 0-25,0-25 15269171 10.1242/dev.01270 0950-1991 Development Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks Imai 2004 7 586 chr09p 207678 207703 3500412677 25 207678 207703 8421504 1 25 0 c,g 350041267700000002,350041267700000002 0-25,0-25 Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos ev.biologists.org 0 0 586 chr09p 207678 207703 3500293514 25 207678 207703 8421504 1 25 0 c,g 350029351400000002,350029351400000002 0-25,0-25 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 586 chr09p 207678 207703 3500233803 25 207678 207703 8421504 1 25 0 c,g 350023380300000002,350023380300000002 0-25,0-25 21693510 10.1242/dev.058131 0950-1991 Development Ci-Pem-1 localizes to the nucleus and represses somatic gene transcription in the germline of Ciona intestinalis embryos Shirae-Kurabayashi 2011 7 597 chr09p 1697450 1697500 3500448531 50 1697450 1697500 8421504 1 50 0 g 350044853100000032 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 600 chr09p 1996178 1996477 3500035118 42 1996178 1996477 8421504 2 23,19 0,280 c,g 350003511800000003,350003511800000004,350003511800000004 0-23,0-19,0-19 ScienceDirect.com - Mechanisms of Development - Retinoic acid affects gene expression and morphogenesis without upregulating the retinoic acid receptor in the ascidian Ciona intestinalis sciencedirect.com 0 0 600 chr09p 1996206 1996477 3500021751 45 1996206 1996477 8421504 2 26,19 0,252 p 350002175100015009 0-45 Peptide fragments of calreticulin, peptide mimetics thereof, and pharmaceutical compostions comprising same Dedhar 1995 0 600 chr09p 1996212 1996498 3500368073 60 1996212 1996498 8421504 2 20,40 0,246 p 350036807300015011,350036807300015032 0-48,0-48 Multimeric forms of members of the steroid/thyroid superfamily of receptors with the ultraspiracle receptor Evans 1994 0 600 chr09p 1996221 1996495 3500111789 48 1996221 1996495 8421504 2 11,37 0,237 p 350011178900015039 0-48 Retinoid receptor compositions and methods Evans 1991 0 612 chr09p 3664920 3664945 3500181527 24 3664920 3664945 8421504 2 11,13 0,12 g 350018152700000023 0-24 Modélisation de la thérapie génique du syndrome mitochondrial MELAS exploitant la voie d'adressage des ARNt dans les mitochondries eses.u-strasbg.fr 0 0 614 chr09p 3829310 3832464 3500032030 45 3829310 3832464 8421504 3 11,9,25 0,263,3129 c,g 350003203000000001,350003203000000000,350003203000000000 3-23,9-34,9-34 15750182 10.1242/dev.01688 0950-1991 Development Patterning across the ascidian neural plate by lateral Nodal signalling sources Hudson 2005 7 588 chr09q 470100 470125 3500228956 25 470100 470125 8421504 1 25 0 c,g 350022895600000013,350022895600000013 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 588 chr09q 470100 470125 3500193888 25 470100 470125 8421504 1 25 0 c,g 350019388800000013,350019388800000013 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 594 chr09q 1245157 1245186 3500260509 29 1245157 1245186 8421504 1 29 0 g 350026050900000001,350026050900000000 0-27,0-27 19824898 10.1111/j.1440-169X.2009.01136.x 1440-169X Development, Growth & Differentiation Transcriptional regulation of the retinoic acid receptor in the dorsal midline epidermis in the Ciona intestinalis embryo - Koyano - 2009 - Development, Growth & Differentiation - Wiley Online Library Koyano 2009 0 598 chr09q 1741211 1741494 3500030744 72 1741211 1741494 8421504 2 44,28 0,255 p 350003074400015012 0-72 METHODS AND COMPOSITIONS FOR ASSESSING AND TREATING CANCER - YALE UNIVERSITY www.sumobrain.com 0 0 598 chr09q 1741211 1741467 3500046035 45 1741211 1741467 8421504 2 44,1 0,255 p 350004603500015270 0-45 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 599 chr09q 1840314 1840341 3500121427 23 1840314 1840341 8421504 3 12,6,5 0,13,22 c 350012142700000081,350012142700000083 1-24,1-24 METHODS FOR DIAGNOSING IRRITABLE BOWEL SYNDROME - Patent application www.faqs.org 0 0 601 chr09q 2119170 2119230 3500109190 60 2119170 2119230 8421504 1 60 0 p 350010919000015037,350010919000015026 6-60,0-60 <HTML> <HEAD><TITLE>i1/4(c)i1/4(c)aaaa$?a1/2a!a(c)a1/4a1/4eoa1/4aaaeae"a"aacae ,cc(c)a(r)a www.j-tokkyo.com 0 0 602 chr09q 2290675 2295044 3500132887 44 2290675 2295044 8421504 2 20,24 0,4345 g 350013288700000000,350013288700000001 20-40,22-46 BMC Evolutionary Biology BioMed Central biomedcentral.com 0 0 602 chr09q 2353544 2353943 3500115195 48 2353544 2353943 8421504 2 20,28 0,371 p 350011519500015040 0-48 Method For Analyzing Cell Free Notch Cleavage And Method For Drug Screening .freshpatents.com 0 0 606 chr09q 2868790 2868813 3500054063 23 2868790 2868813 8421504 1 23 0 g 350005406300000116,350005406300000000,350005406300000015,350005406300000101 8-42,7-41,8-42,7-41 Polypeptides Having Antimicrobial Activity And Polynucleotides Encoding Same .freshpatents.com 0 0 608 chr09q 3027291 3027317 3500416901 23 3027291 3027317 8421504 2 9,14 0,12 g 350041690100000033 2-40 Patent Mutant E. coli strains, and their use for producing recombinant polypeptides (Patent US:6632639) Dreyfus 2003 0 608 chr09q 3027291 3027317 3500034889 23 3027291 3027317 8421504 2 9,14 0,12 g 350003488900000033 2-40 Mutant E. coli strains, and their use for producing recombinant polypeptides Dreyfus 2001 0 609 chr09q 3252202 3253269 3500346363 49 3252202 3253269 8421504 2 21,28 0,1039 g 350034636300000100,350034636300000099 8-29,8-36 Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells Hamilton 2003 0 609 chr09q 3252202 3253269 3500107455 49 3252202 3253269 8421504 2 21,28 0,1039 g 350010745500000100,350010745500000099 8-29,8-36 Patent Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells (Patent US:7625756) Hamilton 2009 0 609 chr09q 3252202 3253269 3500051815 49 3252202 3253269 8421504 2 21,28 0,1039 g 350005181500000100,350005181500000099 8-29,8-36 Patent Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells (Patent US:7625756) Hamilton 2009 0 609 chr09q 3253241 3253269 3500337443 28 3253241 3253269 8421504 1 28 0 g 350033744300000097 8-36 Expression of class 2 mannosidase and class iii mannosidase in lower eukaryotic cells Bobrowicz 2005 0 610 chr09q 3321805 3328649 3500305932 716 3321805 3328649 8421504 2 203,513 0,6331 g 350030593200000084,350030593200000042,350030593200000043,350030593200000085,350030593200000044,350030593200000045 0-203,0-20,0-25,0-513,0-22,0-23 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 610 chr09q 3323811 3323836 3500228956 25 3323811 3323836 8421504 1 25 0 c,g 350022895600000021,350022895600000021 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 610 chr09q 3323811 3323836 3500193888 25 3323811 3323836 8421504 1 25 0 c,g 350019388800000021,350019388800000021 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 611 chr09q 3510078 3510126 3500448531 48 3510078 3510126 8421504 1 48 0 g 350044853100000000 0-48 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 592 chr10p 973701 974230 3500316042 24 973701 974230 8421504 2 23,1 0,528 c 350031604200000027 0-24 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 592 chr10p 973711 974354 3500097418 75 973711 974354 8421504 4 13,14,30,18 0,518,535,625 p 350009741800015007 0-75 Hemendra-Thesis Corected (1) www.scribd.com 0 0 592 chr10p 973717 974270 3500391642 48 973717 974270 8421504 2 7,41 0,512 p 350039164200015005,350039164200015011 0-45,0-45 Method to produce recombinant MBP8298 and other polypeptides by nucleotide structure optimization - Patent # 8527211 - PatentGenius .patentgenius.com 0 0 593 chr10p 1050531 1050556 3500228956 25 1050531 1050556 8421504 1 25 0 g 350022895600000020 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 593 chr10p 1050531 1050556 3500193888 25 1050531 1050556 8421504 1 25 0 g 350019388800000020 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 596 chr10p 1534525 1534552 3500089778 24 1534525 1534552 8421504 2 16,8 0,19 g 350008977800000000 0-24 ScienceDirect.com - FEBS Letters - The retroviral proteinase active site and the N-terminus of Ddi1 are required for repression of protein secretion sciencedirect.com 0 0 597 chr10p 1582716 1584727 3500444677 49 1582716 1584727 8421504 2 25,24 0,1987 c,g 350044467700000001,350044467700000001,350044467700000000,350044467700000000 9-34,9-34,9-33,9-33 17015434 10.1101/gad.1467706 0890-9369 Genes & Development FGF signaling delineates the cardiac progenitor field in the simple chordate, Ciona intestinalis Davidson 2006 12 598 chr10p 1713590 1713615 3500228956 25 1713590 1713615 8421504 1 25 0 c,g 350022895600000014,350022895600000014 0-25,0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 598 chr10p 1713590 1713615 3500193888 25 1713590 1713615 8421504 1 25 0 c,g 350019388800000014,350019388800000014 0-25,0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 588 chr10q 512040 514597 3500118536 43 512040 514597 8421504 2 22,21 0,2536 c,g 350011853600000012,350011853600000013,350011853600000013 10-32,10-31,10-31 10.1002/dvdy.21213 1097-0177 Developmental Dynamics Lineage-independent mosaic expression and regulation of the Ciona multidom gene in the ancestral notochord - Oda-Ishii - 2007 - Developmental Dynamics - Wiley Online Library Oda-Ishii 2007 0 589 chr10q 527576 529600 3500316310 178 527576 529600 8421504 8 22,23,22,21,26,21,19,24 0,1494,1670,1710,1734,1861,1921,2000 c,g 350031631000000000,350031631000000002,350031631000000003,350031631000000004,350031631000000007,350031631000000009,350031631000000014,350031631000000014,350031631000000008,350031631000000008,350031631000000001 10-32,0-23,0-22,0-21,0-21,16-39,0-21,0-21,0-19,0-19,9-33 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 589 chr10q 527576 529600 3500252358 178 527576 529600 8421504 8 22,23,22,21,26,21,19,24 0,1494,1670,1710,1734,1861,1921,2000 c,g 350025235800000000,350025235800000002,350025235800000003,350025235800000004,350025235800000006,350025235800000008,350025235800000013,350025235800000013,350025235800000007,350025235800000007,350025235800000001 10-32,0-23,0-22,0-21,0-21,16-39,0-21,0-21,0-19,0-19,9-33 A combinatorial code of maternal GATA, Ets and -catenin- TCF transcription factors specifies and patterns the early ascidian ectoderm ev.biologists.org 0 0 589 chr10q 527576 529600 3500084881 178 527576 529600 8421504 8 22,23,22,21,26,21,19,24 0,1494,1670,1710,1734,1861,1921,2000 c,g 350008488100000000,350008488100000002,350008488100000003,350008488100000004,350008488100000007,350008488100000009,350008488100000014,350008488100000014,350008488100000008,350008488100000008,350008488100000001 10-32,0-23,0-22,0-21,0-21,16-39,0-21,0-21,0-19,0-19,9-33 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 591 chr10q 809293 811757 3500416406 39 809293 811757 8421504 2 19,20 0,2444 g 350041640600000027,350041640600000026 0-19,0-20 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 596 chr10q 1569305 1569350 3500390472 39 1569305 1569350 8421504 2 23,16 0,29 c 350039047200000073 21-60 Characterizing components of the Dictyostelium centrosome b.uni-muenchen.de 0 0 600 chr10q 2049299 2078327 3500305932 3160 2049299 2078327 8421504 9 537,246,300,371,289,407,604,199,207 0,961,3058,5280,13867,18113,24266,25620,28821 g 350030593200000092,350030593200000058,350030593200000059,350030593200000093,350030593200000060,350030593200000061,350030593200000094,350030593200000062,350030593200000063,350030593200000095,350030593200000064,350030593200000065,350030593200000096,350030593200000066,350030593200000067,350030593200000097,350030593200000068,350030593200000069,350030593200000098,350030593200000070,350030593200000071,350030593200000099,350030593200000072,350030593200000073,350030593200000100,350030593200000074,350030593200000075,350030593200000101,350030593200000076,350030593200000077 0-537,0-20,0-22,0-246,0-22,0-21,0-300,0-21,0-21,0-371,0-21,0-20,0-289,0-20,0-22,0-407,0-22,0-20,0-395,0-21,0-23,0-223,0-21,0-22,0-199,0-21,0-23,0-207,0-22,0-22 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 606 chr10q 2829930 2833252 3500185870 102 2829930 2833252 8421504 6 27,15,9,3,18,30 0,2200,2660,2818,3252,3292 c 350018587000000005,350018587000000017,350018587000000016,350018587000000004 0-27,0-24,0-21,0-30 Supporting Information www.pnas.org 0 0 607 chr10q 2943809 2944239 3500022688 90 2943809 2944239 8421504 2 21,69 0,361 p 350002268800015023 0-90 テンサイの細胞質雄性不稔性におけるミトコンドリア遺 Issue Date http://hdl.handle.net/2115/12155 lib.hokudai.ac.jp 0 0 ATP5A1 609 chr10q 3236458 3241127 3500413115 46 3236458 3241127 8421504 2 22,24 0,4645 c,g 350041311500000043,350041311500000006,350041311500000044,350041311500000007,350041311500000007 11-33,15-36,14-38,19-43,19-43 Aptamers And Methods For Their In Vitro Selection And Uses Thereof www.docstoc.com 0 0 609 chr10q 3236458 3241127 3500377605 45 3236458 3241127 8421504 2 21,24 0,4645 c,g 350037760500000006,350037760500000007,350037760500000007 15-36,19-43,19-43 Aptamers and methods for their in vitro selection and uses thereof - Patent #08105982 w.strutpatent.com 0 0 609 chr10q 3237714 3244297 3500305932 981 3237714 3244297 8421504 3 396,311,274 0,4685,6309 g 350030593200000087,350030593200000048,350030593200000049,350030593200000088,350030593200000051,350030593200000089,350030593200000053 0-396,0-21,0-21,0-311,0-20,0-274,0-21 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 609 chr10q 3240241 3240377 3500041334 45 3240241 3240377 8421504 2 12,33 0,103 p 350004133400015059 0-45 Human Nkx-2.2 polypeptide-encoding nucleotide sequences - Patent # 6239258 - PatentGenius .patentgenius.com 0 0 610 chr10q 3332495 3332550 3500304259 55 3332495 3332550 8421504 1 55 0 g 350030425900000161 0-55 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 612 chr10q 3551015 3551043 3500190185 25 3551015 3551043 8421504 3 4,5,16 0,5,12 c 350019018500000177 3-28 Application # 2005/0037966. Keratinocyte growth factor-2 - Patents.com patents.com 0 0 614 chr10q 3911291 3911668 3500399398 120 3911291 3911668 8421504 2 29,91 0,286 p 350039939800015054,350039939800015048 0-51,0-120 Recurrent gene fusions in prostate cancer Tomlins 2006 0 614 chr10q 3911291 3911668 3500183291 120 3911291 3911668 8421504 2 29,91 0,286 p 350018329100015052,350018329100015046 0-51,0-120 Patent Recurrent gene fusions in prostate cancer (Patent US:7718369) Tomlins 2010 0 614 chr10q 3911291 3911668 3500036124 120 3911291 3911668 8421504 2 29,91 0,286 p 350003612400015051,350003612400015045 0-51,0-120 Recurrent gene fusions in prostate cancer Chinnaiyan 2007 0 592 chr12p 1007969 1009703 3500255511 40 1007969 1009703 8421504 2 20,20 0,1714 c,g 350025551100000010,350025551100000011,350025551100000011 0-20,0-20,0-20 21196932 10.1038/nature09631 Nature Ependymal cells of chordate larvae are stem-like cells that form the adult nervous system. Horie 2011 0 592 chr12p 1025352 1032749 3500363160 141 1025352 1032749 8421504 6 26,57,4,14,18,22 0,6981,7244,7249,7267,7375 c,g 350036316000000007,350036316000000007,350036316000000006,350036316000000003,350036316000000014,350036316000000015,350036316000000004 12-38,12-38,14-45,14-44,0-36,0-36,8-30 22627287 10.1242/dev.078485 0950-1991 Development FGF signaling establishes the anterior border of the Ciona neural tube Wagner 2012 7 592 chr12p 1026742 1026793 3500351312 51 1026742 1026793 8421504 1 51 0 p 350035131200015009,350035131200015040 0-48,0-48 Animal model Enerback 2000 0 595 chr12p 1382127 1382157 3500184539 25 1382127 1382157 8421504 2 10,15 0,15 g 350018453900000009 0-25 Dispense di Struttura e funzione dei genomi (genomica e trascrittomica) rofs.sci.univr.it 0 0 595 chr12p 1429722 1429833 3500362691 48 1429722 1429833 8421504 2 24,24 0,87 c 350036269100000072,350036269100000071 0-24,0-24 Highly polymorphic microsatellites 00Graphicraft Limited, Hong Kong in the lacertid Gallotia galloti ents.plant.wur.nl 0 0 597 chr12p 1703776 1703804 3500149560 23 1703776 1703804 8421504 2 8,15 0,13 g 350014956000000001 1-25 20332151 10.1242/dev.044610 Development (Cambridge, England) Direct activation of Shroom3 transcription by Pitx proteins drives epithelial morphogenesis in the developing gut Mei-I 2010 0 596 chr12q 1479643 1479925 3500257451 45 1479643 1479925 8421504 2 12,33 0,249 p 350025745100015172 0-45 METHOD FOR IDENTIFYING THERAPEUTICAL TARGETS IN SECONDARY TUMORS, THE USE OF THEREOF AND MEANS FOR IDENTIFYING, LABELLING AND TARGETING SECONDARY TUMORS - Patent application www.faqs.org 0 0 605 chr12q 2691932 2691958 3500365490 23 2691932 2691958 8421504 3 6,13,4 0,8,22 g 350036549000000023 16-39 Process For The Production Of Delta5-unsaturated Fatty Acids In Transgenic Organisms .freshpatents.com 0 0 605 chr12q 2691932 2691958 3500354733 23 2691932 2691958 8421504 3 6,13,4 0,8,22 g 350035473300000023 13-36 Process For The Production Of .DELTA.5 www.docstoc.com 0 0 605 chr12q 2691932 2691958 3500161481 23 2691932 2691958 8421504 3 6,13,4 0,8,22 g 350016148100000023 13-36 Process for the production of Δ5-unsaturated fatty acids in transgenic organisms - US Patent 7723574 Description ww.patentstorm.us 0 0 606 chr12q 2766505 2766531 3500068825 23 2766505 2766531 8421504 2 7,16 0,10 g 350006882500000159 5-28 Methods for cloning and manipulating genomes Benders 2011 0 608 chr12q 3106455 3106479 3500363604 24 3106455 3106479 8421504 1 24 0 g 350036360400000009 0-24 18510713 10.1111/j.1440-169X.2008.01039.x 1440-169X Development, Growth & Differentiation RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo - Nishiyama - 2008 - Development, Growth & Differentiation - Wiley Online Library Nishiyama 2008 0 76 chr12q 3405779 3414856 3500276492 62 3405779 3414856 8421504 3 1,27,34 0,428,9043 c 350027649200000013,350027649200000012,350027649200000000 0-28,7-29,0-25 Distinct cytoskeleton populations and extensive crosstalk control Ciona notochord tubulogenesis ev.biologists.org 0 0 588 chr13p 490540 490566 3500046493 24 490540 490566 8421504 2 7,17 0,9 g 350004649300000028 0-24 Epidemiological studies of cryptosporidiosis mro.massey.ac.nz 0 0 587 chr13q 358480 364746 3500185870 157 358480 364746 8421504 8 28,24,15,11,11,14,27,27 0,54,3027,3479,3605,4101,5348,6239 c 350018587000000000,350018587000000032,350018587000000012,350018587000000013,350018587000000033,350018587000000001 0-28,15-39,0-26,0-25,9-36,0-27 Supporting Information www.pnas.org 0 0 591 chr13q 874293 874321 3500216241 23 874293 874321 8421504 2 16,7 0,21 g 350021624100000497 7-30 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 596 chr13q 1462909 1462943 3500448531 34 1462909 1462943 8421504 1 34 0 g 350044853100000030 5-39 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 599 chr13q 1952459 1952487 3500275217 23 1952459 1952487 8421504 3 6,13,4 0,10,24 g 350027521700000009 2-27 Frontiers in Zoology BioMed Central biomedcentral.com 0 0 600 chr13q 1996756 1996781 3500228956 25 1996756 1996781 8421504 1 25 0 g 350022895600000012 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 600 chr13q 1996756 1996781 3500193888 25 1996756 1996781 8421504 1 25 0 g 350019388800000012 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 585 chr14p 85563 85684 3500401782 121 85563 85684 8421504 1 121 0 c 350040178200000000 0-121 <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 3.2//EN"> <HTML> <HEAD> <TITLE> [BiO BB] Using blast to ioinformatics.org 0 0 591 chr14p 821973 859707 3500144883 43 821973 859707 8421504 4 14,6,10,13 0,17,37708,37721 g 350014488300000350,350014488300000210 27-48,15-38 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 593 chr14p 1051236 1051262 3500190185 23 1051236 1051262 8421504 2 15,8 0,18 g 350019018500000162 17-40 Application # 2005/0037966. Keratinocyte growth factor-2 - Patents.com patents.com 0 0 594 chr14p 1275648 1279628 3500255511 40 1275648 1279628 8421504 2 20,20 0,3960 c,g 350025551100000003,350025551100000003,350025551100000002 0-20,0-20,0-20 21196932 10.1038/nature09631 Nature Ependymal cells of chordate larvae are stem-like cells that form the adult nervous system. Horie 2011 0 594 chr14p 1309354 1309403 3500448531 49 1309354 1309403 8421504 1 49 0 g 350044853100000038 1-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 596 chr14p 1547217 1547244 3500116624 23 1547217 1547244 8421504 2 14,9 0,18 g 350011662400000005 0-23 22666864 10.1590/S0074-02762012000400013 0074-0276 Memórias do Instituto Oswaldo Cruz Memórias do Instituto Oswaldo Cruz - Footprints of a trypanosomatid RNA world: pre-small subunit rRNA processing by spliced leader addition trans-splicing Mayer 2012 2 596 chr14p 1558218 1558685 3500080229 48 1558218 1558685 8421504 2 27,21 0,446 p 350008022900015098 0-48 <HTML> <HEAD><TITLE>e>>C/aaPa3/4!a$? - c1ei1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4 | j-tokkyo www.j-tokkyo.com 0 0 597 chr14p 1614896 1616346 3500185870 48 1614896 1616346 8421504 2 20,28 0,1422 g 350018587000000020,350018587000000009 0-20,0-28 Supporting Information www.pnas.org 0 0 599 chr14p 1844082 1862003 3500458112 40 1844082 1862003 8421504 3 6,14,20 0,7,17901 g 350045811200000061,350045811200000044 0-20,6-26 Sequential triplex real-time PCR assay for detecting 21 pneumococcal capsular serotypes that account for a high global disease burden. - ResearchGate .researchgate.net 0 0 600 chr14p 2027899 2027932 3500193771 27 2027899 2027932 8421504 3 17,6,4 0,22,29 g 350019377100000011 15-43 ISOPROPYL ALCOHOL-PRODUCING BACTERIUM AND METHOD OF PRODUCING ISOPROPYL ALCOHOL USING THE SAME Takebayashi 2008 0 602 chr14p 2285792 2294909 3500070867 166 2285792 2294909 8421504 6 21,47,40,20,19,19 0,8091,8139,8189,8302,9098 g 350007086700000082,350007086700000056,350007086700000079,350007086700000049,350007086700000060,350007086700000059,350007086700000058,350007086700000057,350007086700000048,350007086700000054,350007086700000047,350007086700000046,350007086700000038 0-21,10-34,24-43,9-30,0-40,0-40,0-40,0-40,10-29,10-30,10-30,10-29,10-29 講演・学会発表リスト ww.konan-fiber.jp 0 0 605 chr14p 2659602 2660983 3500452170 45 2659602 2660983 8421504 2 31,14 0,1367 p 350045217000015058 0-45 US Patent # 6,706,509. Oncoprotein protein kinase - Patents.com www.patents.com 0 0 605 chr14p 2659602 2660983 3500029292 45 2659602 2660983 8421504 2 31,14 0,1367 p 350002929200015058 0-45 US Patent # 6,863,888. Oncoprotein protein kinase - Patents.com www.patents.com 0 0 587 chr14q 371332 371360 3500458112 23 371332 371360 8421504 2 16,7 0,21 g 350045811200000056 3-30 Sequential triplex real-time PCR assay for detecting 21 pneumococcal capsular serotypes that account for a high global disease burden. - ResearchGate .researchgate.net 0 0 591 chr14q 904226 904276 3500448531 50 904226 904276 8421504 1 50 0 g 350044853100000016 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 592 chr14q 1017355 1017381 3500163139 24 1017355 1017381 8421504 3 6,4,14 0,7,12 g 350016313900000001 1-28 PROCESS FOR PRODUCING ARACHIDONIC ACID AND/OR EICOSAPENTAENOIC ACID IN PLANTS - Patent application www.faqs.org 0 0 594 chr14q 1284539 1284566 3500008109 23 1284539 1284566 8421504 3 7,12,4 0,10,23 g 350000810900000152 4-27 Parasitic nematode transglutaminase proteins and uses thereof Chandrashekar 1997 0 598 chr14q 1717278 1766464 3500216241 39 1717278 1766464 8421504 3 20,13,6 0,49166,49180 g 350021624100002398,350021624100002538 8-28,19-38 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 598 chr14q 1773185 1773210 3500193888 25 1773185 1773210 8421504 1 25 0 c 350019388800000001 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 600 chr14q 2024879 2025267 3500242047 48 2024879 2025267 8421504 2 19,29 0,359 p 350024204700015006 0-48 Proteínas recombinantes ligadas a TAT e sua aplicação terapêutica na reversão de dano isquêmico de ilhotas pancreáticas: impacto em transplante bdtd.bce.unb.br 0 0 600 chr14q 2024879 2025267 3500050686 48 2024879 2025267 8421504 2 19,29 0,359 p 350005068600015003 0-48 Reversal of streptozotocin-induced diabetes in mice by cellular transduction with recombinant pancreatic transcription factor betesjournals.org 0 0 601 chr14q 2219096 2219424 3500305932 328 2219096 2219424 8421504 1 328 0 g 350030593200000090,350030593200000054,350030593200000055 0-328,0-22,0-23 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 603 chr14q 2372913 2372963 3500448531 50 2372913 2372963 8421504 1 50 0 g 350044853100000039 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 607 chr14q 2910153 2910181 3500010941 24 2910153 2910181 8421504 2 11,13 0,15 g 350001094100000023 5-29 Polynucleic acid sequences for use in the detection and differentiation of prokaryotic organisms Giesendorf 1997 0 607 chr14q 2918208 2918517 3500419967 42 2918208 2918517 8421504 2 20,22 0,287 c,g 350041996700000007,350041996700000006 8-28,8-30 16207759 10.1242/dev.02051 0950-1991 Development Uncoupling heart cell specification and migration in the simple chordate Ciona intestinalis Davidson 2005 7 609 chr14q 3149770 3149793 3500306361 23 3149770 3149793 8421504 1 23 0 g 350030636100000065 13-38 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 585 scaffold_1045 753 787 3500163139 26 753 787 8421504 3 6,8,12 0,10,22 g 350016313900000094 5-32 PROCESS FOR PRODUCING ARACHIDONIC ACID AND/OR EICOSAPENTAENOIC ACID IN PLANTS - Patent application www.faqs.org 0 0 585 scaffold_105 104692 119537 3500444677 44 104692 119537 8421504 2 19,25 0,14820 c,g 350044467700000004,350044467700000003 10-29,12-37 17015434 10.1101/gad.1467706 0890-9369 Genes & Development FGF signaling delineates the cardiac progenitor field in the simple chordate, Ciona intestinalis Davidson 2006 12 585 scaffold_1058 13352 13376 3500459627 23 13352 13376 8421504 2 5,18 0,6 g 350045962700000078 1-24 METHODS OF INCREASING GENE EXPRESSION THROUGH RNA PROTECTION - Patent application www.faqs.org 0 0 587 scaffold_106 358736 358761 3500185870 25 358736 358761 8421504 1 25 0 g 350018587000000028 0-25 Supporting Information www.pnas.org 0 0 585 scaffold_1155 13055 13166 3500362691 48 13055 13166 8421504 2 24,24 0,87 g 350036269100000071,350036269100000072 0-24,0-24 Highly polymorphic microsatellites 00Graphicraft Limited, Hong Kong in the lacertid Gallotia galloti ents.plant.wur.nl 0 0 586 scaffold_119 156573 161062 3500409385 86 156573 161062 8421504 4 21,22,22,21 0,31,2314,4468 c,g 350040938500000007,350040938500000007,350040938500000015,350040938500000015,350040938500000014,350040938500000006 0-21,0-21,0-22,0-22,0-22,1-22 Tunicate Gonadotropin-Releasing Hormone (GnRH) Peptides Selectively Activate Ciona intestinalis Receptors and the Green Monkey Type II GnRH Receptor .endojournals.org 0 0 586 scaffold_126 237075 237142 3500065677 67 237075 237142 8421504 1 67 0 g 350006567700000117 0-67 Phylogenetic Position of Foraminifera Inferred from LSU rRNA Gene Sequences brary.arizona.edu 0 0 585 scaffold_1264 11394 11443 3500448531 49 11394 11443 8421504 1 49 0 g 350044853100000035 1-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 587 scaffold_145 284435 284459 3500085562 24 284435 284459 8421504 1 24 0 g 350008556200000305 16-40 Methods and compositions for assaying analytes Yuan 1999 0 586 scaffold_153 142173 142198 3500239718 25 142173 142198 8421504 1 25 0 g 350023971800000003 5-30 22642675 10.1186/1741-7007-10-45 1741-7007 BMC Biology Monoaminergic modulation of photoreception in ascidian: evidence for a proto-hypothalamo-retinal territory Razy-Krajka 2012 6 585 scaffold_162 25397 25953 3500388445 556 25397 25953 8421504 1 556 0 p,g 350038844500000005,350038844500015000 0-557,0-51 Characterization of a notochord-speciﬁc enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis ev.biologists.org 0 0 585 scaffold_162 25436 25523 3500118536 45 25436 25523 8421504 2 24,21 0,66 c,g 350011853600000020,350011853600000019 10-34,9-30 10.1002/dvdy.21213 1097-0177 Developmental Dynamics Lineage-independent mosaic expression and regulation of the Ciona multidom gene in the ancestral notochord - Oda-Ishii - 2007 - Developmental Dynamics - Wiley Online Library Oda-Ishii 2007 0 585 scaffold_162 25448 25473 3500062816 25 25448 25473 8421504 1 25 0 c,g 350006281600000012,350006281600000012 6-31,6-31 ScienceDirect.com - Current Biology - Ascidian prickle Regulates Both Mediolateral and Anterior-Posterior Cell Polarity of Notochord Cells sciencedirect.com 0 0 585 scaffold_162 25539 25940 3500316310 51 25539 25940 8421504 2 27,24 0,377 g 350031631000000013,350031631000000012 6-33,9-33 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 585 scaffold_162 25539 25940 3500084881 51 25539 25940 8421504 2 27,24 0,377 g 350008488100000013,350008488100000012 6-33,9-33 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 585 scaffold_162 25916 25940 3500252358 24 25916 25940 8421504 1 24 0 g 350025235800000011 9-33 A combinatorial code of maternal GATA, Ets and -catenin- TCF transcription factors specifies and patterns the early ascidian ectoderm ev.biologists.org 0 0 585 scaffold_165 85911 86240 3500381625 45 85911 86240 8421504 2 36,9 0,320 p 350038162500015023 0-45 KVLQT1—a long QT syndrome gene Keating 2000 0 KCNQ2 585 scaffold_165 85923 86255 3500343942 48 85923 86255 8421504 2 24,24 0,308 p 350034394200015023 0-48 Polymorphisms associated with ion-channel disease - US Patent Application 20050089905 Description ww.patentstorm.us 0 0 KCNQ5 585 scaffold_165 87965 88926 3500188973 98 87965 88926 8421504 6 19,6,22,15,11,25 0,428,469,504,912,936 c,g 350018897300000000,350018897300000001,350018897300000001,350018897300000003,350018897300000002,350018897300000002 0-25,0-22,0-22,0-26,0-25,0-25 22042987 10.1085/jgp.201110677 0022-1295 The Journal of General Physiology KCNQ1 subdomains involved in KCNE modulation revealed by an invertebrate KCNQ1 orthologue Nakajo 2011 4 586 scaffold_165 133828 133878 3500448531 50 133828 133878 8421504 1 50 0 g 350044853100000009 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 585 scaffold_168 10998 20743 3500118536 92 10998 20743 8421504 4 21,23,26,22 0,36,2299,9723 g 350011853600000018,350011853600000017,350011853600000004,350011853600000027 9-30,11-34,0-26,0-22 10.1002/dvdy.21213 1097-0177 Developmental Dynamics Lineage-independent mosaic expression and regulation of the Ciona multidom gene in the ancestral notochord - Oda-Ishii - 2007 - Developmental Dynamics - Wiley Online Library Oda-Ishii 2007 0 585 scaffold_178 20549 20575 3500459869 23 20549 20575 8421504 2 18,5 0,21 g 350045986900000606 2-28 Highly Conserved Genes And Their Use To Generate Probes And Primers For Detection Of Microorganisms www.docstoc.com 0 0 585 scaffold_178 20549 20575 3500214186 23 20549 20575 8421504 2 18,5 0,21 g 350021418600000438 2-28 Highly conserved genes and their use to generate probes and primers for detection of microorganisms - Patent application www.faqs.org 0 0 585 scaffold_178 20549 20575 3500205565 23 20549 20575 8421504 2 18,5 0,21 g 350020556500000451,350020556500000446 2-28,2-28 HIGHLY CONSERVED GENES AND THEIR USE TO GENERATE PROBES AND PRIMERS FOR DETECTION OF MICROORGANISMS - Patent application www.faqs.org 0 0 585 scaffold_1785 1853 2474 3500267359 621 1853 2474 8421504 1 621 0 g 350026735900000003,350026735900000000,350026735900000012,350026735900000014,350026735900000009,350026735900000020,350026735900000018,350026735900000010,350026735900000013,350026735900000001,350026735900000015,350026735900000002,350026735900000016,350026735900000011 61-680,67-264,141-338,15-216,211-408,1-395,2-396,0-213,0-384,0-213,0-213,0-153,0-150,0-59 By Clone or Sequence Name - BioInfo (public_page) [05 Sep 2013 18:33:14 ] cs.nimr.mrc.ac.uk 0 0 585 scaffold_180 17368 17396 3500287758 25 17368 17396 8421504 2 9,16 0,12 g 350028775800000069 19-44 G protein coupled receptors and uses thereof Gaitanaris 2004 0 585 scaffold_180 17368 17396 3500283183 25 17368 17396 8421504 2 9,16 0,12 g 350028318300000068 19-44 G protein coupled receptors and uses thereof Bergmann 2006 0 585 scaffold_180 17368 17396 3500281132 25 17368 17396 8421504 2 9,16 0,12 g 350028113200000069 19-44 G protein coupled receptors and uses thereof Bergmann 2005 0 585 scaffold_180 17368 17396 3500187417 25 17368 17396 8421504 2 9,16 0,12 g 350018741700000069 19-44 G protein coupled receptors and uses thereof E 2004 0 585 scaffold_180 17368 17396 3500098888 25 17368 17396 8421504 2 9,16 0,12 g 350009888800000068 19-44 G protein coupled receptors and uses thereof Bergmann 2006 0 585 scaffold_180 28565 28591 3500418362 23 28565 28591 8421504 2 15,8 0,18 g 350041836200000000 0-23 Conferences, Proceedings, Journals, Open Access Journals, SCIRP file.scirp.org 0 0 585 scaffold_180 28565 28591 3500380558 23 28565 28591 8421504 2 15,8 0,18 g 350038055800000001 0-23 Detection and differentiation of Cryptosporidium hominis and Cryptosporidium parvum by dual TaqMan assays m.sgmjournals.org 0 0 585 scaffold_180 28565 28591 3500370882 23 28565 28591 8421504 2 15,8 0,18 g 350037088200000000 0-23 Frequency of Emerging Parasites in HIV/AIDS and Oncological Patients Stool by Coprological and Molecular Analysis www.scirp.org 0 0 585 scaffold_180 28565 28591 3500195295 23 28565 28591 8421504 2 15,8 0,18 g 350019529500000000 0-23 Identification of Emerging Parasites in HIV Patients Stool by Molecular Analysis ww.scienpress.com 0 0 585 scaffold_185 103298 108153 3500274391 139 103298 108153 8421504 5 42,15,30,30,22 0,616,1882,1976,4833 c,g 350027439100000006,350027439100000005,350027439100000004,350027439100000004,350027439100000003,350027439100000003,350027439100000007,350027439100000007 0-30,0-30,0-30,0-30,0-30,0-30,0-22,0-22 ScienceDirect.com - FEBS Letters - A new transglutaminase-like from the ascidian Ciona intestinalis sciencedirect.com 0 0 585 scaffold_186 60078 60330 3500304173 66 60078 60330 8421504 2 30,36 0,216 p 350030417300015002 6-72 BMC Evolutionary Biology BioMed Central biomedcentral.com 0 0 585 scaffold_186 69250 69459 3500305932 209 69250 69459 8421504 1 209 0 g 350030593200000102,350030593200000079 0-209,0-21 Scienze dello sviluppo e del movimento umano rato.cib.unibo.it 0 0 585 scaffold_187 31238 35030 3500377029 232 31238 35030 8421504 8 45,51,21,23,20,11,40,21 0,504,659,966,1382,1499,3685,3771 p,c,g 350037702900015002,350037702900015001,350037702900000004,350037702900000004,350037702900000001,350037702900000003,350037702900000003,350037702900015000,350037702900000000,350037702900000000 0-45,0-51,0-21,0-21,0-23,0-20,0-20,0-51,0-21,0-21 16951378 0022-1767 The Journal of Immunology First Identification of a Chemotactic Receptor in an Invertebrate Species: Structural and Functional Characterization of Ciona intestinalis C3a Receptor Melillo 2006 6 585 scaffold_187 32737 34963 3500416511 51 32737 34963 8421504 2 11,40 0,2186 p 350041651100015003 0-51 Fish & Shell sh Immunology www.lambris.com 0 0 585 scaffold_1899 6231 6260 3500438877 27 6231 6260 8421504 3 4,6,17 0,5,12 g 350043887700000013,350043887700000029 1-28,1-28 Transgenic Zebrafish - Patent application www.faqs.org 0 0 585 scaffold_198 23624 23669 3500257087 45 23624 23669 8421504 1 45 0 p 350025708700015176 0-45 Chimeric GFP-aequorin as bioluminescent Ca&plus &plus reporters at the single cell level Baubet 2001 0 SYT1 585 scaffold_199 64113 64138 3500228956 25 64113 64138 8421504 1 25 0 g 350022895600000019 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 585 scaffold_199 64113 64138 3500193888 25 64113 64138 8421504 1 25 0 g 350019388800000019 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 585 scaffold_200 129629 129677 3500210212 48 129629 129677 8421504 1 48 0 p 350021021200015002 0-48 Specific oligobodies against ERK-2 that recognize both the native and the denatured state of the protein. - ResearchGate .researchgate.net 0 0 MAPK1 585 scaffold_205 64709 64733 3500357655 24 64709 64733 8421504 1 24 0 g 350035765500000004 0-24 Phenotypic plasticity in the Caribbean sponge Callyspongia vaginalis (Porifera: Haplosclerida) people.uncw.edu 0 0 585 scaffold_209 44065 44091 3500259094 23 44065 44091 8421504 2 12,11 0,15 g 350025909400000006 0-23 四川大学本科毕业论文 - 豆丁网 www.docin.com 0 0 585 scaffold_212 44499 44523 3500216241 23 44499 44523 8421504 2 8,15 0,9 g 350021624100000364 0-26 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 585 scaffold_228 49713 50126 3500422108 44 49713 50126 8421504 2 23,21 0,392 g 350042210800000000 8-119 NPG.nature.vol.409.Issue.6819.Jan www.scribd.com 0 0 585 scaffold_2325 5687 5740 3500099369 37 5687 5740 8421504 5 15,4,8,4,6 0,19,27,39,47 g 350009936900000115 0-37 METHODS AND COMPOSITIONS FOR PREVENTING A CONDITION - Patent application www.faqs.org 0 0 590 scaffold_26 686959 687019 3500306837 60 686959 687019 8421504 1 60 0 p 350030683700015000 0-60 IDENTIFICATION OF A cDNA ASSOCIATED WITH VENTRICULAR FUNCTION IN HUMAN MYOCARDIAL TISSUE Bednarik 2001 0 TRIM54 585 scaffold_275 63586 64234 3500099386 105 63586 64234 8421504 2 48,57 0,591 p 350009938600015001,350009938600015014,350009938600015013 0-48,0-45,0-45 Assay for Monitoring Activity of Jmjd6 Schofield 2009 0 HIST2H2BC,HIST2H3C 585 scaffold_275 63586 63634 3500335119 48 63586 63634 8421504 1 48 0 p 350033511900015003 0-48 A. (2009) Science, 325 (5936), pp. 90-93. penrepository.com 0 0 H3F3A 585 scaffold_275 63592 63637 3500063417 45 63592 63637 8421504 1 45 0 p 350006341700015230 0-45 Chromatin regulator genes - Patent # 7252968 - PatentGenius .patentgenius.com 0 0 HIST3H3 585 scaffold_275 63592 63637 3500062658 45 63592 63637 8421504 1 45 0 p 350006265800015004 0-45 ACTIVATION AND ACTIVATORS OF SIRT6 - Patent application www.faqs.org 0 0 HIST3H3 585 scaffold_275 63928 63973 3500135859 45 63928 63973 8421504 1 45 0 p 350013585900015005 3-48 TUMOR-SPECIFIC ANTIGENS, CYTOTOXIC T LYMPHOCYTES RESPONSIVE THERETO, AND METHODS OF USING THE SAME - MEMORIAL SLOAN-KETTERING CANCER CENTER www.sumobrain.com 0 0 HIST2H3C 585 scaffold_275 63952 64195 3500448005 210 63952 64195 8421504 3 72,45,93 0,93,150 p 350044800500015211,350044800500015210,350044800500015209,350044800500015208,350044800500015207 0-72,0-45,0-45,0-72,0-45 Use of MVA to treat prostate cancer Delcayre 2010 0 HIST2H3C 585 scaffold_275 64144 64234 3500178085 90 64144 64234 8421504 1 90 0 p 350017808500015000 0-90 Gene regulation www.scribd.com 0 0 HIST2H3C 585 scaffold_275 64162 64234 3500456986 72 64162 64234 8421504 1 72 0 p 350045698600015001 0-72 Histone deacetylase-related gene and protein Bhatia 2002 0 HIST2H3C 585 scaffold_275 64162 64234 3500116277 72 64162 64234 8421504 1 72 0 p 350011627700015001 0-72 Histon-Desacetylasen der Klasse II: Entdeckung, Klonierung und funktionelle Charakterisierung der enzymatischen Aktivität einer neuen Gruppe humaner HDACs .uni-tuebingen.de 0 0 HIST2H3C 585 scaffold_275 64171 64225 3500411785 54 64171 64225 8421504 1 54 0 p 350041178500015017 0-54 Characterization of the Substrate Specificity and Mechanism of Protein Arginine Methyltransferase 1 alcommons.usu.edu 0 0 HIST1H4K 585 scaffold_275 64177 64234 3500112966 57 64177 64234 8421504 1 57 0 p 350011296600015000 0-57 Mutations in Saccharomyces cerevisiae Gene SIR2 Can Have Differential Effects on In Vivo Silencing Phenotypes and In Vitro Histone Deacetylation Activity web.mit.edu 0 0 HIST2H3C 585 scaffold_275 64177 64234 3500002602 57 64177 64234 8421504 1 57 0 p 350000260200015000 0-57 11950950 10.1091/mbc.01-10-0482 1059-1524 Molecular Biology of the Cell Mutations in Saccharomyces cerevisiae GeneSIR2 Can Have Differential Effects on In Vivo Silencing Phenotypes and In Vitro Histone Deacetylation Activity Armstrong 2002 5 HIST1H4K 585 scaffold_275 64180 64234 3500397268 54 64180 64234 8421504 1 54 0 p 350039726800015000 0-54 acetylated histone h4: Topics by Science.gov www.science.gov 0 0 HIST1H4K 585 scaffold_275 64180 64234 3500232415 54 64180 64234 8421504 1 54 0 p 350023241500015000 0-54 10.1038/sj.embor.7400391 EMBO Reports The histone-binding code of nuclear receptor co-repressors matches the substrate specificity of histone deacetylase 3 Helen 2005 0 HIST2H3C 585 scaffold_275 64186 64234 3500025867 48 64186 64234 8421504 1 48 0 p 350002586700015004 0-48 12486003 10.1093/emboj/cdf682 ERROR! NO ISSN The EMBO Journal In vivo destabilization of dynamic microtubules by HDAC6-mediated deacetylation Matsuyama 2002 0 HIST2H3C 585 scaffold_275 64189 64234 3500077114 45 64189 64234 8421504 1 45 0 p 350007711400015010 0-45 Absence of effects of Sir2 overexpression on lifespan in C. elegans and Drosophila. - ResearchGate .researchgate.net 0 0 HIST1H4K 585 scaffold_275 64189 64234 3500039059 45 64189 64234 8421504 1 45 0 p 350003905900015009 0-45 Absence of effects of Sir2 overexpression on lifespan in C. elegans and Drosophila roup.linkgroup.hu 0 0 HIST2H3C 585 scaffold_276 3868 3892 3500427469 24 3868 3892 8421504 1 24 0 c 350042746900000001 0-24 ARTICLE IN PRESS www.uni-kiel.de 0 0 585 scaffold_283 9559 9584 3500085562 24 9559 9584 8421504 2 19,5 0,20 g 350008556200000100 8-32 Methods and compositions for assaying analytes Yuan 1999 0 585 scaffold_308 42552 42924 3500408327 127 42552 42924 8421504 4 32,25,43,27 0,136,178,345 c,g 350040832700000717,350040832700000717,350040832700001227,350040832700001385,350040832700000955,350040832700001045,350040832700000557,350040832700001033,350040832700001425,350040832700001425 13-45,13-45,25-50,25-50,16-59,6-49,11-54,0-40,15-42,15-42 GABI Primary Database ( GabiPD ) - Genomanalyse im biologischen System Pflanze gabi.rzpd.de 0 0 585 scaffold_308 42651 42717 3500346018 66 42651 42717 8421504 1 66 0 p 350034601800015014 0-66 CHARACTERIZATION OF LpSK6: A LYCOPERSICON .diagnosisnet.com 0 0 GSK3A 585 scaffold_316 65722 65770 3500448531 48 65722 65770 8421504 1 48 0 g 350044853100000001 0-48 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 585 scaffold_317 30966 30992 3500190186 23 30966 30992 8421504 2 10,13 0,13 g 350019018600000068 19-42 G PROTEIN COUPLED RECEPTORS AND USES THEREOF Gaitanaris 2010 0 585 scaffold_317 30966 30992 3500049212 23 30966 30992 8421504 2 10,13 0,13 g 350004921200000068 19-42 G protein coupled receptors and uses thereof Gaitanaris 2003 0 585 scaffold_3228 5311 5336 3500376159 23 5311 5336 8421504 2 11,12 0,13 g 350037615900000065 0-31 Stabilized polypeptide compositions - Patent application www.faqs.org 0 0 585 scaffold_3228 5311 5336 3500343478 23 5311 5336 8421504 2 11,12 0,13 g 350034347800000066 0-31 Stabilized polypeptide compositions Glaser 2007 0 585 scaffold_3457 195 222 3500014750 23 195 222 8421504 2 6,17 0,10 g 350001475000000607 10-33 www.pnas.org 0 0 585 scaffold_355 46897 49633 3500395187 50 46897 49633 8421504 2 25,25 0,2711 g 350039518700000004,350039518700000005 0-25,0-25 19193647 10.1074/jbc.M809672200 0021-9258 Journal of Biological Chemistry Comprehensive Egg Coat Proteome of the Ascidian Ciona intestinalis Reveals Gamete Recognition Molecules Involved in Self-sterility Yamada 2009 5 585 scaffold_36 98773 98802 3500316042 29 98773 98802 8421504 1 29 0 g 350031604200000011 0-29 Monitoring for propagules of Ciona intestinalis in marine water samples: the development of temporal gene expression markers for viability and life stage specific assays www.reabic.net 0 0 590 scaffold_36 681898 681922 3500416406 24 681898 681922 8421504 1 24 0 c,g 350041640600000006,350041640600000006 0-24,0-24 17332536 10.1242/dev.002220 0950-1991 Development ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles Chambon 2007 7 585 scaffold_3757 574 599 3500454641 25 574 599 8421504 1 25 0 g 350045464100000005 0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 585 scaffold_4066 723 795 3500454960 70 723 795 8421504 2 39,31 0,41 g 350045496000000040,350045496000000043 51-121,51-121 Phylogenetic and Phylogeographic Study of the New Zealand Endemic Sea Tunicate Cnemidocarpa nisiotis .canterbury.ac.nz 0 0 585 scaffold_4097 3241 3264 3500022998 23 3241 3264 8421504 1 23 0 g 350002299800000318,350002299800000184,350002299800000194,350002299800000453,350002299800000355 2-27,2-27,5-30,14-39,3-27 Novel Acetylcholinesterase Gene Responsible for Insecticide Resistance and Applications Thereof - Patent application www.faqs.org 0 0 585 scaffold_420 29669 29705 3500306361 29 29669 29705 8421504 4 15,6,4,4 0,20,27,32 g 350030636100000127 9-39 PAAD domain-containing polypeptides, encoding nucleic acids, and methods of use - Patent application www.faqs.org 0 0 585 scaffold_4354 798 821 3500144883 23 798 821 8421504 1 23 0 g 350014488300000647 18-43 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 587 scaffold_44 306024 306075 3500430551 51 306024 306075 8421504 1 51 0 p 350043055100015001 0-51 Novel murine and human kinases Anderson 2000 0 MAP2K2 587 scaffold_44 306024 306075 3500349597 51 306024 306075 8421504 1 51 0 p 350034959700015019,350034959700015243 0-51,0-48 Methods For Identifying Compounds That Alter Kinase Activity www.docstoc.com 0 0 TSPAN33 587 scaffold_44 306024 306075 3500220810 51 306024 306075 8421504 1 51 0 p 350022081000015001 0-51 Novel murine and human kinases Anderson 2002 0 MAP2K2 587 scaffold_44 306024 306075 3500157094 51 306024 306075 8421504 1 51 0 p 350015709400015011 0-51 Patent Methods for identifying compounds that alter kinase activity (Patent US:6514719) Bird 2003 0 TSPAN33 587 scaffold_44 306024 306075 3500156707 51 306024 306075 8421504 1 51 0 p 350015670700015015 0-51 Patent Calcium/calmodulin-dependent kinase (Patent US:6759223) Bird 2004 0 MAP2K2 587 scaffold_44 306024 306075 3500156219 51 306024 306075 8421504 1 51 0 p 350015621900015011 0-51 Antibodies to novel murine and human kinases Anderson 2006 0 MAP2K2 587 scaffold_44 306024 306075 3500089714 51 306024 306075 8421504 1 51 0 p 350008971400015011 0-51 Methods for identifying compounds that alter kinase activity Bird 2000 0 MAP2K2 587 scaffold_44 306024 306075 3500026875 51 306024 306075 8421504 1 51 0 p 350002687500015011 0-51 Novel murine and human kinases Anderson 2008 0 MAP2K2 587 scaffold_44 306027 306093 3500327386 66 306027 306093 8421504 1 66 0 p 350032738600015029 0-66 Site-Specific Incorporation of Phosphoserine Into Proteins in Escherichia Coli Park 2011 0 MAP2K2 588 scaffold_44 433105 436241 3500358987 915 433105 436241 8421504 10 45,8,70,44,178,75,78,57,50,310 0,93,444,520,750,1171,1258,1952,2042,2826 p 350035898700015039,350035898700015030,350035898700015029,350035898700015022,350035898700015016,350035898700015006,350035898700015001 0-45,0-78,0-120,0-177,0-135,0-90,0-270 Supporting Information www.pnas.org 0 0 590 scaffold_47 700706 700732 3500159803 26 700706 700732 8421504 1 26 0 g 350015980300000000 0-26 Expansion of the Actin Gene Family in Amphioxus ww.bioline.org.br 0 0 590 scaffold_47 701316 724905 3500363604 46 701316 724905 8421504 3 25,12,9 0,23498,23580 c,g 350036360400000010,350036360400000011 0-25,0-21 18510713 10.1111/j.1440-169X.2008.01039.x 1440-169X Development, Growth & Differentiation RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo - Nishiyama - 2008 - Development, Growth & Differentiation - Wiley Online Library Nishiyama 2008 0 590 scaffold_47 701645 701668 3500201536 23 701645 701668 8421504 1 23 0 g 350020153600000004 0-23 21124978 10.1371/journal.pone.0014047 1932-6203 PLOS ONE PLOS ONE: The Orphan Adhesion-GPCR GPR126 Is Required for Embryonic Development in the Mouse Waller-Evans 2010 4 POTEM 590 scaffold_47 701645 701668 3500144744 23 701645 701668 8421504 1 23 0 g 350014474400000004 0-23 21124978 10.1371/journal.pone.0014047 PLoS ONE The Orphan Adhesion-GPCR GPR126 Is Required for Embryonic Development in the Mouse Helen 2010 0 590 scaffold_47 704982 725051 3500357484 40 704982 725051 8421504 3 14,5,21 0,15,20048 c,g 350035748400000002,350035748400000003 1-20,22-43 Vascular Endothelial Growth Factor Receptor Family in Ascidians, Halocynthia roretzi (Sea Squirt). Its High Expression in Circulatory System-Containing Tissues www.mdpi.com 0 0 590 scaffold_47 704982 725051 3500337436 40 704982 725051 8421504 3 14,5,21 0,15,20048 c,g 350033743600000002,350033743600000003 1-20,22-43 BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 586 scaffold_63 230819 231089 3500453822 60 230819 231089 8421504 2 47,13 0,257 p 350045382200015007 0-60 Asymmetric expression of BbPtx in lancelets ev.biologists.org 0 0 586 scaffold_63 230819 231089 3500318145 60 230819 231089 8421504 2 47,13 0,257 p 350031814500015010 0-60 Left-right asymmetric expression of BbPtx, a Ptx-related gene, in a lancelet species and the developmental left-sidedness in deuterostomes. - ResearchGate .researchgate.net 0 0 585 scaffold_65 114226 114251 3500228956 25 114226 114251 8421504 1 25 0 c 350022895600000003 0-25 Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system ev.biologists.org 0 0 585 scaffold_65 114226 114251 3500193888 25 114226 114251 8421504 1 25 0 c 350019388800000003 0-25 19088089 10.1242/dev.026419 0950-1991 Development Gene regulatory networks underlying the compartmentalization of the Ciona central nervous system Imai 2009 7 587 scaffold_67 361272 361343 3500226227 54 361272 361343 8421504 4 4,18,17,15 0,5,29,56 c 350022622700000016 187-248 Social Amoebas Comparative Genome Browser Suhnel 0 587 scaffold_67 385307 385357 3500448531 50 385307 385357 8421504 1 50 0 g 350044853100000022 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 586 scaffold_71 184551 185591 3500448531 91 184551 185591 8421504 3 22,46,23 0,246,1017 g 350044853100000049,350044853100000002,350044853100000047,350044853100000046 0-22,0-44,0-19,0-23 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 587 scaffold_71 276142 276171 3500031595 24 276142 276171 8421504 2 14,10 0,19 g 350003159500000011 0-24 DNA MOLECULES AND METHODS - Patent application www.faqs.org 0 0 585 scaffold_713 36541 36566 3500216241 25 36541 36566 8421504 1 25 0 g 350021624100000097 1-26 #- #- editor #- Fri May 11 12:33:53 2001 #- #- #- Reference sequence: E.coli #- Attributes: #= a.ccbb.utexas.edu 0 0 585 scaffold_7393 0 1031 3500454960 328 0 1031 8421504 5 12,273,3,19,21 0,14,319,548,1010 g 350045496000000032,350045496000000026,350045496000000028,350045496000000044,350045496000000042,350045496000000033,350045496000000001 523-681,548-831,548-830,548-809,548-809,0-150,0-21 Phylogenetic and Phylogeographic Study of the New Zealand Endemic Sea Tunicate Cnemidocarpa nisiotis .canterbury.ac.nz 0 0 585 scaffold_7393 361 875 3500066713 52 361 875 8421504 3 14,23,15 0,288,499 g 350006671300000003 0-84 First Molecular Evidence for the Existence of a Tardigrada + Arthropoda Clade | Gonzalo Giribet - Academia.edu www.academia.edu 0 0 585 scaffold_7480 1010 1037 3500438730 27 1010 1037 8421504 1 27 0 g 350043873000000011 0-27 SISTEMÁTICA MOLECULAR DEL GÉNERO FISSURELLA EN EL PACÍFICO SUDORIENTAL dspace.usc.es 0 0 585 scaffold_773 215 238 3500346164 23 215 238 8421504 1 23 0 g 350034616400000000 0-23 Studying Sources of Incongruence In Arthropod Molecular Phylogenies: Sea Spiders (Pycnogonida) As a Case Study | Alexandre Hassanin - Academia.edu www.academia.edu 0 0 585 scaffold_773 35688 35714 3500018081 26 35688 35714 8421504 1 26 0 g 350001808100000272 1-27 Primers of use in Molecular Phylogenetic Research Diptera-Specific Polymerase Chain Reaction Amplification www.uoguelph.ca 0 0 585 scaffold_7745 811 991 3500065677 52 811 991 8421504 3 6,14,32 0,9,148 g 350006567700000016,350006567700000039 4-25,0-32 Phylogenetic Position of Foraminifera Inferred from LSU rRNA Gene Sequences brary.arizona.edu 0 0 585 scaffold_7745 1026 1049 3500093962 23 1026 1049 8421504 1 23 0 g 350009396200000006 0-23 РОССИЙСКАЯ АКАДЕМИЯ НАУК preferat.znate.ru 0 0 585 scaffold_7761 59 699 3500095195 43 59 699 8421504 2 24,19 0,621 g 350009519500000075,350009519500000016 1-25,0-19 Review Article MolecularDiagnosticTestsforMicrosporidia loads.hindawi.com 0 0 585 scaffold_7761 79 1116 3500147387 112 79 1116 8421504 4 36,15,38,23 0,37,54,1014 g 350014738700000076,350014738700000011 0-89,4-27 Phylogenetic Position of the Dicyemid Mesozoa Inferred from 18s rDNA Sequences www.biolbull.org 0 0 585 scaffold_7761 97 702 3500357655 41 97 702 8421504 2 22,19 0,586 g 350035765500000003,350035765500000002 0-22,0-19 Phenotypic plasticity in the Caribbean sponge Callyspongia vaginalis (Porifera: Haplosclerida) people.uncw.edu 0 0 585 scaffold_7761 107 703 3500454960 41 107 703 8421504 2 21,20 0,576 g 350045496000000004,350045496000000005 0-21,0-20 Phylogenetic and Phylogeographic Study of the New Zealand Endemic Sea Tunicate Cnemidocarpa nisiotis .canterbury.ac.nz 0 0 585 scaffold_7761 688 712 3500415528 24 688 712 8421504 1 24 0 g 350041552800000060,350041552800000062 19-43,0-24 Oligonucleotides for amplifying Trichomonas vaginalis-derived nucleic acid Weisburg 2008 0 585 scaffold_7761 688 712 3500369874 24 688 712 8421504 1 24 0 g 350036987400000060,350036987400000062 19-43,0-24 OLIGONUCLEOTIDES FOR AMPLIFYING TRICHOMONAS VAGINALIS-DERIVED NUCLEIC ACID - Patent application www.faqs.org 0 0 585 scaffold_7761 688 712 3500307071 24 688 712 8421504 1 24 0 g 350030707100000060,350030707100000062 19-43,0-24 Oligonucleotides For Amplifying Trichomonas Vaginalis-derived Nucleic Acid .freshpatents.com 0 0 585 scaffold_7761 688 712 3500197836 24 688 712 8421504 1 24 0 g 350019783600000060,350019783600000062 19-43,0-24 Compositions and methods for detecting Trichomonas vaginalis in a sample Weisburg 2004 0 585 scaffold_7761 688 712 3500133429 24 688 712 8421504 1 24 0 g 350013342900000062,350013342900000060 0-24,19-43 METHODS FOR AMPLIFYING TRICHOMONAS VAGINALIS-DERIVED NUCLEIC ACID - Patent application www.faqs.org 0 0 585 scaffold_7761 689 714 3500202973 25 689 714 8421504 1 25 0 g 350020297300000006,350020297300000015 0-25,0-25 Insulin Receptor Binding Peptides with Non-Insulin Gene Activation Profiles and Uses Thereof - US Patent Application 20090197800 Description ww.patentstorm.us 0 0 585 scaffold_7761 690 860 3500295595 42 690 860 8421504 2 22,20 0,150 g 350029559500000005,350029559500000006 0-22,0-20 Helper Virus-Free Herpesvirus Amplicon Particles and Uses Thereof Federoff 2011 0 585 scaffold_7761 690 860 3500288492 42 690 860 8421504 2 22,20 0,150 g 350028849200000005,350028849200000006 0-22,0-20 Helper virus-free herpesvirus amplicon particles and uses thereof Federoff 2007 0 585 scaffold_7761 690 860 3500120028 42 690 860 8421504 2 22,20 0,150 g 350012002800000005,350012002800000031,350012002800000032,350012002800000006 0-22,0-22,0-20,0-20 Helper Virus-Free Herpesvirus Amplicon Particles and Uses Thereof - Patent application www.faqs.org 0 0 585 scaffold_7761 690 860 3500094026 42 690 860 8421504 2 22,20 0,150 g 350009402600000005,350009402600000006 0-22,0-20 Helper virus-free herpesvirus amplicon particles and uses thereof Federoff 2009 0 585 scaffold_7761 690 860 3500086942 42 690 860 8421504 2 22,20 0,150 g 350008694200000005,350008694200000006 0-22,0-20 Helper virus-free herpesvirus amplicon particles and uses thereof Bowers 2005 0 585 scaffold_7761 690 860 3500006613 42 690 860 8421504 2 22,20 0,150 g 350000661300000005,350000661300000006 0-22,0-20 Helper virus-free herpesvirus amplicon particles and uses thereof Federoff 2003 0 585 scaffold_7761 818 866 3500434964 42 818 866 8421504 2 22,20 0,28 g 350043496400000004,350043496400000003 0-22,0-20 Molecular characterization of the insulin-like growth factor-I (IGF-I) gene in channel catfish (Ictalurus punctatus). - ResearchGate .researchgate.net 0 0 585 scaffold_7761 827 851 3500439076 24 827 851 8421504 1 24 0 g 350043907600000000 19-43 2 Recovery of Enteric Microbes in 100-L Tap Water Samples 3 4 Running Title: Ultrafiltration Procedure for Waterborne Microbe Recovery 5 ACCEPTED aem.asm.org 0 0 587 scaffold_78 300610 304930 3500255511 43 300610 304930 8421504 2 23,20 0,4300 g 350025551100000001,350025551100000000 7-30,10-30 21196932 10.1038/nature09631 Nature Ependymal cells of chordate larvae are stem-like cells that form the adult nervous system. Horie 2011 0 585 scaffold_799 29536 29580 3500459207 41 29536 29580 8421504 2 26,15 0,29 g 350045920700000311 131-174 Phylogenetische Charakterisierung von Mikroorganismen aus dem Intestinaltrakt von Insekten imed.uni-mainz.de 0 0 585 scaffold_8057 371 1004 3500408631 75 371 1004 8421504 3 25,21,29 0,481,604 g 350040863100000001,350040863100000002,350040863100000004 0-25,0-21,0-29 Evaluating Hypotheses of Deuterostome Phylogeny and Chordate Evolution with New LSU and SSU Ribosomal DNA Data bpages.uidaho.edu 0 0 585 scaffold_8057 374 398 3500405177 24 374 398 8421504 1 24 0 g 350040517700000000 7-31 MEMORIAS vistainfectio.org 0 0 585 scaffold_8057 374 398 3500303766 24 374 398 8421504 1 24 0 g 350030376600000001 0-24 Evidence from SSU rRNA Phylogeny that Octomitus is a Sister Lineage to Giardia ww3.botany.ubc.ca 0 0 585 scaffold_8057 374 398 3500252499 24 374 398 8421504 1 24 0 g 350025249900000003 0-24 Patent Compositions, products, methods and systems to monitor water and other ecosystems (Patent US:8383342) Rublee 2013 0 585 scaffold_8057 375 398 3500192247 23 375 398 8421504 1 23 0 g 350019224700000002 12-35 Widespread and ancient distribution of a noncanonical genetic code in diplomonads. - ResearchGate .researchgate.net 0 0 585 scaffold_8057 376 757 3500002785 43 376 757 8421504 2 22,21 0,360 g 350000278500000003,350000278500000001 0-22,0-21 Marine triclads (Platyhelminthes, Tricladida, Maricola), a preliminary molecular approach to their phylogeny - ResearchGate .researchgate.net 0 0 585 scaffold_8057 537 896 3500259094 43 537 896 8421504 2 23,20 0,339 g 350025909400000008,350025909400000003 0-23,0-20 四川大学本科毕业论文 - 豆丁网 www.docin.com 0 0 585 scaffold_8057 841 1060 3500418005 39 841 1060 8421504 2 20,19 0,200 g 350041800500000011,350041800500000012 0-20,0-19 cla 143 255. research.amnh.org 0 0 585 scaffold_8113 10 33 3500126691 23 10 33 8421504 1 23 0 g 350012669100000001,350012669100000002 0-23,0-19 First Molecular Evidence for the Existence of a Tardigrada + Arthropoda Clade faculty.uml.edu 0 0 585 scaffold_8136 457 489 3500363705 30 457 489 8421504 2 20,10 0,22 g 350036370500000082 0-30 Host response to Eimeria infections ive.library.uu.nl 0 0 585 scaffold_8136 982 1013 3500065677 31 982 1013 8421504 1 31 0 g 350006567700000062,350006567700000064 59-90,72-99 Phylogenetic Position of Foraminifera Inferred from LSU rRNA Gene Sequences brary.arizona.edu 0 0 585 scaffold_8136 987 1010 3500018081 23 987 1010 8421504 1 23 0 g 350001808100000230,350001808100000226,350001808100000227 7-30,0-21,0-22 Primers of use in Molecular Phylogenetic Research Diptera-Specific Polymerase Chain Reaction Amplification www.uoguelph.ca 0 0 585 scaffold_8249 704 1019 3500454960 92 704 1019 8421504 2 73,19 0,296 g 350045496000000041,350045496000000045 24-97,9-28 Phylogenetic and Phylogeographic Study of the New Zealand Endemic Sea Tunicate Cnemidocarpa nisiotis .canterbury.ac.nz 0 0 585 scaffold_8310 118 142 3500095195 24 118 142 8421504 1 24 0 g 350009519500000051 0-24 Review Article MolecularDiagnosticTestsforMicrosporidia loads.hindawi.com 0 0 585 scaffold_8310 123 148 3500153544 25 123 148 8421504 1 25 0 g 350015354400000000 4-29 A MOLECULAR PHYLOGENETIC ANALYSIS OF REPRODUCTIVE TRAIT EVOLUTION IN THE SOFT CORAL GENUS ALCYONIUM coralresearch.com 0 0 585 scaffold_8310 132 155 3500356921 23 132 155 8421504 1 23 0 g 350035692100000002 0-23 Evaluation of Three Diagnostic Methods, Including Real-Time PCR, for Detection of Dientamoeba fragilis in Stool Specimens jcm.asm.org 0 0 585 scaffold_8310 228 256 3500401194 28 228 256 8421504 1 28 0 g 350040119400000001 0-28 18723640 0006-3185 The Biological Bulletin Morphology and Gene Analysis of Hybrids Between Two Congeneric Sea Stars With Different Modes of Development Wakabayashi 2008 2 585 scaffold_8310 277 301 3500465804 24 277 301 8421504 1 24 0 g 350046580400000000 7-31 ATALASE MAILARI BURUZKO GOGOETAK | sebastian orduz - Academia.edu www.academia.edu 0 0 585 scaffold_8310 277 301 3500185596 24 277 301 8421504 1 24 0 g 350018559600000003 0-24 Patent Compositions, products, methods and systems to monitor water and other ecosystems (Patent US:8048623) Rublee 2011 0 585 scaffold_8310 277 300 3500153550 23 277 300 8421504 1 23 0 g 350015355000000001 0-23 Morphology and phylogenetic position of two novel marine Blackwell Publishing Ltd gregarines (Apicomplexa, Eugregarinorida) from the intestines of North-eastern Paciﬁc ascidians ww3.botany.ubc.ca 0 0 585 scaffold_8310 277 300 3500126691 23 277 300 8421504 1 23 0 g 350012669100000009 0-23 First Molecular Evidence for the Existence of a Tardigrada + Arthropoda Clade faculty.uml.edu 0 0 585 scaffold_8310 280 303 3500423706 23 280 303 8421504 1 23 0 g 350042370600000001 0-23 Linnaeus was right all along: Ulva and Enteromorpha are not distinct genera www.tcd.ie/Zoolog 0 0 585 scaffold_878 18154 18204 3500448531 50 18154 18204 8421504 1 50 0 g 350044853100000034 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 586 scaffold_88 213596 213646 3500448531 50 213596 213646 8421504 1 50 0 g 350044853100000005 0-50 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 586 scaffold_88 220488 220914 3500454641 50 220488 220914 8421504 3 25,7,18 0,34,408 c 350045464100000001,350045464100000000 0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 586 scaffold_88 220488 220914 3500275698 50 220488 220914 8421504 3 25,7,18 0,34,408 c,g 350027569800000001,350027569800000001,350027569800000000 0-25,0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 586 scaffold_88 225174 225267 3500312812 93 225174 225267 8421504 1 93 0 p 350031281200015038 45-138 Zebrafish paralogue group 1 Hox genes ev.biologists.org 0 0 586 scaffold_88 225183 225836 3500357197 156 225183 225836 8421504 2 120,36 0,617 p 350035719700015040 9-165 Introduction to Computational Biology: an evolutionary approach www.scribd.com 0 0 586 scaffold_88 225183 225836 3500022355 156 225183 225836 8421504 2 120,36 0,617 p 350002235500015040 9-165 Introduction to Computational Biology an Evolutionary Approach www.scribd.com 0 0 586 scaffold_88 225240 225845 3500003595 108 225240 225845 8421504 2 63,45 0,560 p 350000359500015000 0-108 Analyse der Expression des proliferationsassoziierten Proteins P8 in Betazellen des endokrinen Pankreas .uni-wuerzburg.de 0 0 586 scaffold_88 225297 225842 3500413458 48 225297 225842 8421504 2 6,42 0,503 p 350041345800015000 0-48 Characterization of a gadolinium-tagged modular contrast agent by element and molecular mass spectrometry lib3.dss.go.th 0 0 588 scaffold_88 421237 423236 3500041770 272 421237 423236 8421504 13 20,20,20,21,22,19,21,21,21,20,21,23,23 0,215,398,476,504,527,549,573,639,872,1008,1043,1976 g 350004177000000004,350004177000000006,350004177000000008,350004177000000012,350004177000000017,350004177000000020,350004177000000015,350004177000000011,350004177000000013,350004177000000009,350004177000000007,350004177000000002,350004177000000005,350004177000000003 0-20,0-20,0-20,0-21,0-20,0-20,0-19,0-21,0-21,0-21,0-20,0-21,0-23,0-23 16835437 10.1242/dev.02448 0950-1991 Development Ci-FoxA-a is the earliest zygotic determinant of the ascidian anterior ectoderm and directly activates Ci-sFRP1/5 Lamy 2006 7 73 scaffold_89 520415 525922 3500185870 74 520415 525922 8421504 3 27,21,26 0,582,5481 g 350018587000000003,350018587000000014,350018587000000002 0-27,0-21,0-26 Supporting Information www.pnas.org 0 0 588 scaffold_92 434924 438674 3500055469 141 434924 438674 8421504 3 53,25,63 0,2270,3687 p 350005546900015010,350005546900015006 0-78,0-63 Molecular Characterization of CDC42, a Saccharomyces cerevisiae Gene Involved in the Development of Cell Polarity jcb.rupress.org 0 0 CDC42 588 scaffold_92 434957 437219 3500046035 45 434957 437219 8421504 2 20,25 0,2237 p 350004603500015276 0-45 Method of identifying compounds useful to treat neuronal degenerative diseases - Patent application www.faqs.org 0 0 CDC42 588 scaffold_92 438626 438671 3500009992 45 438626 438671 8421504 1 45 0 p 350000999200015106 0-45 Assays and reagents for identifying anti-fungal agents, and uses related thereto Berlin 1998 0 CDC42 585 scaffold_925 16842 16866 3500304259 24 16842 16866 8421504 1 24 0 c 350030425900000163 13-37 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00009 or.nimr.mrc.ac.uk 0 0 587 scaffold_95 328794 328842 3500430809 48 328794 328842 8421504 1 48 0 p 350043080900015023 0-48 Patent Search: US Patent Number 8299236 - Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells ww.archpatent.com 0 0 ISL1 587 scaffold_95 328794 328842 3500415188 48 328794 328842 8421504 1 48 0 p 350041518800015007 0-48 Synthetic Lipid Rafts and Methods of Use Khan 2007 0 ISL1 587 scaffold_95 328794 328842 3500324849 48 328794 328842 8421504 1 48 0 p 350032484900015003,350032484900015036 48-96,0-48 Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells Chen 2005 0 ISL1 587 scaffold_95 328794 328842 3500313912 48 328794 328842 8421504 1 48 0 p 350031391200015006 0-48 Synthetic lipid rafts and methods of use Khan 2007 0 ISL1 587 scaffold_95 328794 328842 3500292820 48 328794 328842 8421504 1 48 0 p 350029282000015079 0-48 Lipopeptides for delivery of nucleic acids Adami 2010 0 ISL2 587 scaffold_95 328794 328842 3500208064 48 328794 328842 8421504 1 48 0 p 350020806400015038 0-48 COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY Cui 2007 0 ISL1 587 scaffold_95 328794 328842 3500188627 48 328794 328842 8421504 1 48 0 p 350018862700015022 0-48 COMPOSITIONS AND METHODS FOR ENHANCING DELIVERY OF NUCLEIC ACIDS INTO CELLS AND FOR MODIFYING EXPRESSION OF TARGET GENES IN CELLS - Patent application www.faqs.org 0 0 ISL1 587 scaffold_95 328794 328842 3500100022 48 328794 328842 8421504 1 48 0 p 350010002200015087 0-48 Peptide-dicer substrate rna conjugates as delivery vehicles for sirna Ahmadian 2007 0 ISL2 587 scaffold_95 328794 328842 3500001458 48 328794 328842 8421504 1 48 0 p 350000145800015006 0-48 Cell-penetrating peptides and bioactive cargoes. Strategies and mechanisms. w.diva-portal.org 0 0 ISL1 588 scaffold_95 398320 398345 3500454641 25 398320 398345 8421504 1 25 0 c,g 350045464100000010,350045464100000010 0-25,0-25 20335361 10.1242/dev.046938 0950-1991 Development Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis Ikuta 2010 7 588 scaffold_95 398320 398345 3500275698 25 398320 398345 8421504 1 25 0 c,g 350027569800000010,350027569800000010 0-25,0-25 Limited functions of Hox genes in the larval development of the ascidian Ciona intestinalis ev.biologists.org 0 0 588 scaffold_95 470888 470913 3500316310 25 470888 470913 8421504 1 25 0 g 350031631000000016 0-25 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 588 scaffold_95 470888 470913 3500084881 25 470888 470913 8421504 1 25 0 g 350008488100000016 0-25 17965050 10.1242/dev.010850 0950-1991 Development A combinatorial code of maternal GATA, Ets and β-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Rothbacher 2007 7 585 scaffold_950 4488 4534 3500448531 44 4488 4534 8421504 2 24,20 0,26 g 350044853100000040 0-44 20186916 10.1002/dvdy.22254 1097-0177 Developmental Dynamics Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs - Hozumi - 2010 - Developmental Dynamics - Wiley Online Library Hozumi 2010 0 587 scaffold_96 365369 366672 3500185870 98 365369 366672 8421504 5 24,27,11,14,22 0,211,657,1106,1281 c 350018587000000011,350018587000000023,350018587000000022,350018587000000010 0-24,0-27,0-25,2-24 Supporting Information www.pnas.org 0 0 585 scaffold_972 4163 4186 3500328515 23 4163 4186 8421504 1 23 0 g 350032851500000015 0-43 Patent Cryptosporidium detection method (Patent US:5770368) Leon 1998 0 585 scaffold_972 4920 12701 3500246696 98 4920 12701 8421504 5 24,27,19,16,12 0,7545,7686,7752,7769 g 350024669600000036,350024669600000136,350024669600000137,350024669600000138,350024669600000152,350024669600000161 0-24,1-28,3-26,0-23,4-23,0-28 G Diptera-Speciﬁc Polymerase Chain Reaction Ampliﬁcation Primers of Use in Molecular Phylogenetic Research www.canacoll.org 0 0 585 scaffold_972 4920 12625 3500018081 89 4920 12625 8421504 4 24,23,23,19 0,7518,7548,7686 g 350001808100000036,350001808100000127,350001808100000133,350001808100000138,350001808100000137,350001808100000152 0-24,0-23,0-23,0-23,3-26,4-23 Primers of use in Molecular Phylogenetic Research Diptera-Specific Polymerase Chain Reaction Amplification www.uoguelph.ca 0 0 585 scaffold_972 11766 11789 3500393174 23 11766 11789 8421504 1 23 0 g 350039317400000000 0-23 ScienceDirect.com - Journal of Experimental Marine Biology and Ecology - Determining the native region of the putatively invasive ascidian Didemnum vexillum Kott, 2002 sciencedirect.com 0 0 585 scaffold_972 11766 11789 3500041203 23 11766 11789 8421504 1 23 0 g 350004120300000000 0-23 Genetic conspecificity of the worldwide populations of Didemnum vexillum Kott, 2002 shole.er.usgs.gov 0 0 586 scaffold_99 213443 213473 3500407203 27 213443 213473 8421504 2 20,7 0,23 g 350040720300000072 19-46 G Protein Coupled Receptors And Uses Thereof .freshpatents.com 0 0 586 scaffold_99 213443 213472 3500089862 26 213443 213472 8421504 2 20,6 0,23 g 350008986200000068 19-45 G protein coupled receptors and uses thereof Bergmann 2011 0